... how qualitative findings link to and confirm quantitative findings, as well as how quantitative findings inform qualitative findings – thereby validating findings and enhancing generalizability ... related to social and relational capital, and linkage mechanisms Fragmentation in the knowledge translation field, and an attendant need for programmatic investigations and integration of disciplines ... interested in collaborating to build sustainable capacity to use research findings in the LTC sector (e.g., Health Quality Councils of Alberta and Saskatchewan, Health Canada) Strategic dissemination:...
Ngày tải lên: 11/08/2014, 05:21
... how qualitative findings link to and confirm quantitative findings, as well as how quantitative findings inform qualitative findings – thereby validating findings and enhancing generalizability ... related to social and relational capital, and linkage mechanisms Fragmentation in the knowledge translation field, and an attendant need for programmatic investigations and integration of disciplines ... interested in collaborating to build sustainable capacity to use research findings in the LTC sector (e.g., Health Quality Councils of Alberta and Saskatchewan, Health Canada) Strategic dissemination:...
Ngày tải lên: 11/08/2014, 16:20
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... corporate, a medium-sized corporate, as well as a startup He maintains a blog at http://pankajghanshani.com, and you can follow him on Twitter at @PankajGhanshani and find him on Linkedin at http://www.linkedin.com /in/ pankajghanshani ... manager on the ground can and should be able to improve what they today by creating new processes and products An MNC manager in India has a significant opportunity to be innovative and add new ... can lead to an information gap that is readily filled by the grapevine This has created a new kind of challenge for managers—that of finding a reliable source of information and keeping an adequate...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "TEXTUAL EXPERTISE IN WORD EXPERTS: AN APPROACH TO TEXT PARSING BASED ON TOPIC/COMMENT MONITORING" potx
... FACT exists examine the frame corresponding to FACT if ANNOT - FRAME or ANNOT - WEXP and annotations of type SACT or SVAL exist examine f as frame, s as slot, and v as slot value, resp according ... phenomena in texts, e.g pronominal anaphora, conjunction, delxls, word experts are available similar in structure, but adapted to identify corresponding phenomena if ANNOT - FRAME and an annotation ... is beta ancestor to string str CASCADING THEMES ( f , f', f'' , f''" , sir ) fram-e f is alpha ancestor f" & frame f" is beta ancestor to f'" & frame f'" is alpha ancestor to f''" & frame f''"...
Ngày tải lên: 31/03/2014, 17:20
Báo cáo khoa học: An answer to a question by Wilf on packing distinct patterns in a permutation potx
... the above class of permutations lends itself to proof, like Wilf’s, it is a tradeoff between manageability and performance We have only counted a restricted number of patterns in certain less than ... length n + that contains π as well as at least 2f (π) patterns This, with the upper bound, would be a clean proof that h(n) grows asymptotically as 2n and allow for more understanding of how h(n) ... insignificant, as n k with k! As n n < k! k for all k above a breakpoint which grows much slower than n Wilf demonstrated a class of permutations Wn for which f (Wn ) asymptotically is √ greater than...
Ngày tải lên: 07/08/2014, 08:20
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...
Ngày tải lên: 04/10/2012, 10:02
Moving to a New City pptx
... I found out a lot of interesting things about his life Apparently, he grew up in San Francisco He and his parents didn't get on at all, and when he was 18 he decided to see America He set off ... money and traveled east He carried on until he reached New York, where he got a job washing dishes in a restaurant He felt in love with one of the waitresses, and one day he turned up at her flat ... married an cư lạc and settle down? nghiệp Reading & Listening Các bạn đọc đoạn văn để hiểu cách sử dụng cụm động từ học 00:00 Grandfather's Diaries I recently read my grandfather's diaries, and...
Ngày tải lên: 25/03/2014, 07:21
Moving to a New City potx
... I found out a lot of interesting things about his life Apparently, he grew up in San Francisco He and his parents didn't get on at all, and when he was 18 he decided to see America He set off ... money and traveled east He carried on until he reached New York, where he got a job washing dishes in a restaurant He felt in love with one of the waitresses, and one day he turned up at her flat ... married an cư lạc and settle down? nghiệp Reading & Listening Các bạn đọc đoạn văn để hiểu cách sử dụng cụm động từ học 00:00 Grandfather's Diaries I recently read my grandfather's diaries, and...
Ngày tải lên: 25/03/2014, 11:21
báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx
... [16] Using the guidance for ligand binding assays [12] as a foundation in which to base the validation of a flow cytometry pharmacodynamic assay and applying the "appropriate" parameters for a cell ... calibration and data analysis A Becton Dickenson FACSCalibur instrument using 488 argon and red-diode lasers was calibrated daily using QC3 calibration beads (Bangs Laboratories) MESF was determined using ... than 10% across all individuals and all days (Table 5) In- study results This assay was used as a pharmacodynamic marker for biological activity of a CCR2 antagonist in a clinical trial consisting...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx
... Statistical analysis Data were analyzed using SAS program for ANOVA The significance of difference between the mean of each Fig Average body weight changes in male adult mice exposed to genistein and ... important factor to maintain fertilization Genistein inhibits the induction of acrosomal exocytosis and binding of spermatozoa to the zona pellucida (ZP) [34] ZP-induced acrosomal exocytosis in ... 10% and artificial illumination of a 12-hr light-dark cycle All animals received humane care as outline with “Guide for the care and use of animals” (Chungbuk National University Animal Care...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo khoa học: "The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning" potx
... contributed to conception and design, acquisition of data and interpretation of data and has been involved in drafting the manuscript RG contributed to conception and design, analysis and interpretation ... of data and has been involved in revising the manuscript critically DN contributed to acquisition of data and revised the manuscript BC contributed to conception and design, analysis and interpretation ... relevant option The second part ("and then you find") presents a new clinical finding, such as a physical sign, a pre-existing condition, an imaging study or a laboratory test result The third part...
Ngày tải lên: 09/08/2014, 09:22
Báo cáo y học: "PEEP-ZEEP technique: cardiorespiratory repercussions in mechanically ventilated patients submitted to a coronary artery bypass graft surgery" doc
... saturation; ETCO2: end-tidal carbon dioxide; Rawinsp: inspiratory resistance; Rawexp: expiratory resistance; Cst: total static lung compliance Values are presented as mean and standard deviation ... mechanics (peak inflation pressure (PIP), plateau pressure (Pplateau), inspiratory flow (Vinsp), expiratory flow (Vexp), inspiratory resistance (Rawinsp), expiratory resistance (Rawexp) and total ... reached 64 ± L/ min, with a significant statistical difference (p < 0.001) (Figures and 4) The inspiratory and expiratory resistance and static compliance parameters indicated slight oscillations,...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf
... Yonezawac M, Maruyamaf K, Yamaguchi-Shinozakif K, Shinozakia K: The MitogenActivated Protein Kinase Cascade MKK3-MPK6 Is an Important Part of the Jasmonate Signal Transduction Pathway in Arabidopsis ... T, MaruyamaNakashita A, Kudo T, Shinozaki K, Yoshida S, Nakashita H: Antagonistic interaction between systemic acquired resistance and the abscisic acidmediated abiotic stress response in Arabidopsis ... Agarwal PK, Jha B: Transcription factors in plants and ABA dependent and independent abiotic stress signalling Biologia Plantarum 2010, 54:201-212 Bari R, Jones JDG: Role of plant hormones in plant...
Ngày tải lên: 11/08/2014, 11:20
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
... designed based on the sequence scaffolds of PGB02 (AATTGGTCAATTCCTAAAACACCATG, AAATTATGGGTTTTAAGGGCTAGAGTTC) and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) ... gDNA The primer sequences (shown in 5'-3' orientation) are CTTTCAAGCCCAATACCCAAAGGCACTG and GGGAATGGCAATCACTGCATTGGTATAG for CYP720B4; and GGAGAATTAGTGAGTCATGTCGATG and CTCTGTCTGATTGGTGGAACAGGC ... -815 and -3,291 in PGB02 and at positions 1,227, -676 and -1,162 (TCAGAAGAGG, GAGAAGAATA and CAGAAAAGGA) in PGB04, respectively This element was first characterised as a cis-acting element involved...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx
... cytoskeleton are surely important factors, but how they interact and details about underlying mechanisms remain unclear Muscle shortening velocity also seems to be an important factor [4,25,26] In addition, ... response in the asthmatic might be that myosin bridges never see strains that large This is perhaps because the majority of the mechanical strain in the asthmatic airway during a DI is taken up by increased ... Series -to- parallel transition in the filament lattice of airway smooth muscle J Appl Physiol 2000, 89:869-876 Fan T, Yang M, Halayko A, Mohapatra SS, Stephens NL: Airway responsiveness in two inbred...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot
... 399:130-132 Banavar JR, Damuth J, Maritan A, Rinaldo A: Supply-demand balance and metabolic scaling Proc Natl Acad Sci USA 2002, 99:10506-10509 Darveau C -A, Suarez RK, Andrews RD, Hochachka PW: Allometric ... Fractal geometry and allometric scaling of organisms Science 1999, 284:1677-1679 Banavar JR, Maritan A, Rinaldo A: Size and form in efficient transportation networks Nature 1999, 399:130-132 Banavar ... bone mass is 1.09 [26], and an average of MLEs of the scaling exponent for brain mass is 0.73 [27] The anatomical conceptualization has also been used to develop a five-compartment anatomical model...
Ngày tải lên: 13/08/2014, 23:20
How Vietnamese Students Adapt to A New Educational Environment when Studying in Australian Institutes A Case Study at La Trobe University
... first thing that I asked of participants was to list differences and similarities between universities in Vietnam and the university in Australia regarding teaching and learning approaches In particular, ... of reasons such as avoiding traffic jams and travelling by a shorter distance” In the final interview, he showed a positive change on his belief of learning in Australia He was more active and ... first interview, she showed that she recognized this was a different learning environment and worked to adapt to the new demands I made an effort to adapt with learning and teaching approaches...
Ngày tải lên: 13/08/2015, 10:21
An introduction to a class of matrix optimization problems
... professionalism and patience His wisdom and attitude will always be a guide to me I feel very fortunate to have him as an adviser and a teacher My deepest thanks go to Professor Toh Kim-Chuan and Professor ... from a wide range of fields such as engineering, finance, and so on, can be cast in the form of MOPs In order to apply the proximal point algorithms (PPAs) to the MOP problems, as an initial step, ... system, and the non-singularity of the corresponding Clarke’s generalized Jacobian, at a KKT point are all equivalent For the (nonlinear and linear) SDP problems, variational analysis on the metric...
Ngày tải lên: 09/09/2015, 18:58
Academic performance, persistence, and degree completion of associate in arts degree recipients transferring to a four year multi campus institution
... encouragement from significant others, financial aid, financial attitudes, and social integration Additionally, the model proposes that precollege academic performance and college grade-point average ... entering freshman enrolling from 1988 to 1995 95% of freshman enrolling during this timeframe are represented in database Database contained key demographic, academic, and financial information on ... Both Astin and Tinto define and explain persistence and attrition of 14 students and look at individual and institutional characteristics Historically, in the study of student retention, Tinto’s...
Ngày tải lên: 30/09/2015, 13:41