... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... when the data manager relinquishes that memory If the data manager does not process and release the data within an adequate period of time, the data may then be paged out to the default pager In ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of access (any combination of read, write, and...
... sound influence on behavioral and attitudinal aspects of individuals An in- depth analysis in each ofthe broad parameters revealed the following: Educational Facet Education plays a vital role in ... MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis ofthe gathered data, which reveal the behaviors and decision making patterns in lower income ... limited by all the MFIs operating in Pakistan The average loan size in Pakistan is ranging from 10,000- 15,000 only Keeping in mind the inflation and ever increasing price in Pakistan, the loan size...
... important to differentiate whether CSM is focusing on the satisfaction ofthe customer organization as a whole or the satisfaction of certain individuals within that organization These are clearly ... expectations and the performance ofthe organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... ABSTRACT There is a lack of research that focuses on the suitability ofthe concept of customer satisfaction and the current methods used for measuring it in organizations operating in business-to-business...
... Master Plan) Institute of Energy Disadvantages and limitations: First new RE Master Plan in VN Financing is limited due to regulation Time is limited Inadequate database Lack of information, analysis, ... Main Contents of RE Master Plan and Some Preliminary results 2.1 Organization of RE MP Present status of RE development 1.1 Existing development in VN 1.2 International experience Evaluation of ... hours/year Wind Energy Wind energy density: 800 – 1400 kWh/m2.year on islands 500 -1000 kWh/m2.year in coastal areas and highlands Other areas: less than 500 kWh/m2.year Biomass Energy Agricultural...
... et al AAA B B Fig AO and SsaDH-coupled enzyme assay (A) The NADPH production inthe assay was determined with the additions as indicated The presence of AO, SsaDH and CH3-4-aminobutyrate as ... CH3-4-aminobutyrate A nicotinovorans pAO1 was able to grow on CH3-4-aminobutyrate only inthe presence of low amounts of nicotine added as inducer ofthe nicotine degradation pathway (Ganas and Brandsch, ... 5¢-CTT CTG AGG ATC CCA AAT GAC AGT-3¢ 5¢-CAT GTA AGC CCC CTC GAG TCG TTC AG-3¢ 5¢-CGT CAC GGT ATT CGA AGC C-3¢ 5¢-CAC TGG CTA ATT CCA GTG C-3¢ 5¢-CAC TAG CGA AGA TGC CGT C-3¢ 5¢-CCA ACG CAG AAA CTC...
... (a) Inthe absence of one or more integral membrane subunits the majority ofthe subunits inthe peripheral-subcomplex are accumulated ina stable form, and most likely already associated ina ... ofthe known mammalian ESSS proteins reveals a high degree of conservation inthe C-terminal domain (including the transmembrane region), but a significant number of differences inthe N-terminal ... Each ofthe mutants was found to have a premature chain-termination codon within the open reading frame In two ofthe mutants (CCL16-B11 and V79-G18) the predicted protein is truncated at a position...
... memories are of viewing seminal national events: the first moon landing, the Viet24 BUT FOR THE WEATHER nam War, and the Watergate hearings While the moon landing produced the sort of cheering and ... mother -in- law, Karin’s — then passed through the second floor ofthe house next door and landed inthe third, killing the family hiding inthe basement Karin’s family, having taken cover in their ... incursions, a corridor with watchdogs, and tripwires attached to machine guns The final barrier always consisted ofthe Mauer feindwärts, the “wall facing the enemy.” The view ofthe Wall from East and...
... unhappiness, was the fact that my brother William was purchased by the same family My father, by his nature, as well as by the habit of transacting business as a skillful mechanic, had more ofthe ... that I did not live on a distant plantation, but ina town not so large that the inhabitants were ignorant of each other's affairs Bad as are the laws and customs ina slaveholding community, the ... coursing inthe veins of American slaves? I have spoken ofthe pains slaveholders take to give their slaves a bad opinion ofthe north; but, notwithstanding this, intelligent slaves are aware that...
... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end ofthe xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location ofthe ... and characterization of xanthine dehydrogenase ina baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings ofthe 11th International Symposium on Flavins and Flavoproteins...
... homogenates of male and female antennae contained an immunoreactive band with an apparent molecular mass of 40 kDa (Fig 1, left, A, B) Inthe sample of primary cell culture of M brassicae, a band ... sequence analysis revealed that the cDNA contains a putative coding region of 1059 bp, encoding a 353 amino-acid protein with a theoretical molecular mass of 41 400 Da and an isoelectric point of 5.35, ... hairs are distributed in two classes according to their length The long ones (long sensilla trichodea) are located on the lateral part ofthe ventral area and are arrayed in four to five parallel...
... indicating that the dominant effect ofthe Ca2+ concentration appears Fig Autocatalytic activation of trypsinogen by trypsin inthe absence or presence of p-amindinobenzamidine (A) Effect of trypsinogen ... Trypsin catalyzes the activation of trypsinogen in an intermolecular autocatalytic process The conversion of trypsinogen to trypsin involves the removal ofthe N-terminal hexapeptide H2N-Val-AspAsp-Asp-Asp-Lys ... period, a rapid increase in trypsin activity was observed The lag phase ofthe S-shaped activation curve is shortened by an increase inthe trypsinogen concentration, and the maximal trypsin activity...
... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that the ... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are more ... Harper Parsec: An architecture for parallel parsing of constraint dependency grammars In Submitted to The Proceedings o /the ~9th Annual Meeting o.f ACL, June 1991 [3] H Maruyama Constraint dependency...
... ELISA-assay remained negative throughout follow-up inofthe seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... experiments To avoid inter-assay variability, all serial samples follow-up of one individual were tested inthe same assay A stimulation index (SI) of >2.5 inthe proliferation assay was considered ... proteins) (*) Patient 13 had a faint band against the C2 protein at the second time point investigated (after HCV clearance) (**) Patient 80 had HCV serotype Genotyping was not performed inthe initial...
... that children ages 8–17 can talk about and respond to items asking them about their health and well-being They can also offer unique insight into the understandability ofthe items These findings ... agreed to allow their child to participate, they were scheduled for an interview date At the time ofthe interview, a trained research assistant obtained parental informed consent and the children ... items, and the basis for the response for each item [9] Cognitive probes elicit information regarding the clarity and rationale ofthe directions, the meaning ofthe items, the appropriateness of the...
... draft the manuscript AlexP participated inthe design ofthe study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness ofthe ... [13] – the recombinant would have fair chances to survive The existence of wt recombinant strains of TULV [10] supports this way of reasoning Evidence for the recombination inthe hantavirus...
... signal or the output of an actual switch Such signals can be used to label the brain signals and to evaluate the performance ofa BI The data analysis of individuals with motor disabilities was ... discard the least informative features based on the amount of information that each feature carries regarding the output classes presence of feature i and a value of "0" indicated its absence in ... over an interval containing the movement onset (measured as the finger switch activation) if no artifact was detected in that particular interval The interval starts at tstart seconds before Page...
... ELISA-assay remained negative throughout follow-up inofthe seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... experiments To avoid inter-assay variability, all serial samples follow-up of one individual were tested inthe same assay A stimulation index (SI) of >2.5 inthe proliferation assay was considered ... proteins) (*) Patient 13 had a faint band against the C2 protein at the second time point investigated (after HCV clearance) (**) Patient 80 had HCV serotype Genotyping was not performed inthe initial...
... draft the manuscript AlexP participated inthe design ofthe study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness ofthe ... [13] – the recombinant would have fair chances to survive The existence of wt recombinant strains of TULV [10] supports this way of reasoning Evidence for the recombination inthe hantavirus...
... Tretiakova M, Jagadeeswaran S, Montag A, Becker A, Kenny HA, Peter ME, Ramakrishnan V, Yamada SD, Lengyel E: Loss of E-cadherin promotes ovarian cancer metastasis via alpha 5-integrin, which is a ... understanding ofthe normal mechanisms could reveal the aberrant features that mediate and maintain the transformed state, especially in solid malignancies [87,89,98] miRNA as targets and/or mediators of ... Mulligan J: Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray Gene 1999, 229:101-108 Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi...