stem cell migration a zebrafish model

... are transported anterogradely from the perikaryon to the axon terminal at a fast and a slow rate In mammals, fast transport advances at 200-400 mm a day while slow transport at 0.2-6 ... but also in a variety of physiological and pathological processes In general, they are crucial participants in receptor-mediated intercellular signaling that regulate cells engaged ... Tay SSW (2002). Activation of apoptotic and N-methyl-Daspartate (NMDA) receptor-calcium-neuronal nitric oxide synthase (nNOS) pathways in the vagal motor nuclei of rats after right vagotomy. Annual...

Ngày tải lên: 16/09/2015, 17:12

... dexamethasone (Sigma-Aldrich, USA), 50 μM l-Ascorbate2-phosphate (Sigma-Aldrich, USA), and 10 mM betaglycerophosphate (Sigma-Aldrich, USA)] for weeks [14] Mineralization was assessed by staining ... Post-operative analgesics contained morphine (Ha Na Pharm, Korea) at 0.15 mg/kg/h, lidocaine HCl (Dai Han Pharm, Korea) at mg/kg/h and ketamine HCl (Yuhan Pharm, Korea) at 0.3 mg/kg/h [26] After ... potentials (SEP) were measured using a Neuropack (Nihon Kohden, Japan) and two subdermal channels at 1, 5, and weeks after the cell transplantation Channel was installed at the subdermal region at...

Ngày tải lên: 07/08/2014, 23:22

... Antisense morpholino (AMO) Sequences of AMO used in this study: Control AMO (ctrl AMO) (CCTCTTACCTCAGTTA CAATTTATA), GAL4 targeting AMO (Gal4 AMO) (GTTCGATAGAAGACAGTAGCTTCAT) [37], and ATG targeting ... 5′-gCATGGTGGCGGCCTTGGAT CCGGAATTCGAATCGATGGGATCCTGCA-3′ B: pCS2-f2: 5′- gcaGGTGGCGGAGGTGGCGTGAG CAAGGGCGAGGAGC-3′ pCS2-r2: 5′- tagCAT GGTGGCGGCCTTGGATCCGGAATTCGAATCG ATGGGATCCTGCA-3′ ggggcc80xRNA ... ggggcc80xRNA A? ??: pCS2-f1: 5′- ggccgcaGGTGGCGGAGGTGGCGT GAGCAAGGGCGAGGAGC-3′ pCS2-r3: 5′- gGGTGGCGGCCTTGGATCCGGA ATTCGAATCGATGGGATCCTGCA-3′ B’ pCS2-f2: 5′- gcaGGTGGCGGAGGTGGC GTGAGCAAGGGCGAGGAGC-3′...

Ngày tải lên: 04/12/2022, 10:34

... is critical to understand the mechanisms by which transplanted neural cells can replace the damaged cells and interact with healthy host cells in a well-organized manner. Cell- based therapy might ... Statistical Analysis Results are expressed as mean ± standard deviation (SD). The non-parametric one-way ANOVA was applied to analyze continuous variables: the gene expression of NGF, BDNF and ... hydrate (Pharmaceutical Plant of Tiantan Hospital, Beijing, China). The rectal tempera- ture was monitored and maintained at 37.5°C. A scalp incision was made behind the superior nuchal line at 0.5...

Ngày tải lên: 18/06/2014, 16:20

... early-passage embryonic stem cells Proc Natl Acad Sci U S A 90, 8424-8428 Nait-Oumesmar, B., Copperman, A. B., and Lazzarini, R .A (2000) Placental expression and chromosomal localization of the human ... Sakaki-Yumoto, M., Kobayashi, C., Sato, A. , Fujimura, S., Matsumoto, Y., Takasato, M., Kodama, T., Aburatani, H., Asashima, M., Yoshida, N., et al (2006) The murine homolog of SALL4, a causative gene in ... Alexander, M., and Pedersen, R .A (2005) Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells J Cell Sci 118, 4495-4509 Varelas, X., Sakuma, R., Samavarchi-Tehrani,...

Ngày tải lên: 11/09/2015, 16:07

... hindlimb ischemia Thuy Thi-Thanh Dao1,§, Ngoc Bich Vu1,§,*, Lan Thi Phi1, Ha Thi -Ngan Le1, Ngoc Kim Phan1,2, Van Thanh Ta3, Phuc Van Pham1,2 Laboratory of Stem Cell Research and Application, University ... ketamine-xylazine, and were fixed to trays Hairy limb was shaved and thigh skin was cut along approximately cm Femoral artery and vein were separated from muscle, and then ligated at sites, one at the femoral ... femoral triangle and the other at the popliteal artery An incision was performed between the ligations Damaged tissue recuperation was evaluated using graded morphological scales at the area of muscle...

Ngày tải lên: 16/12/2017, 18:01

... Dontu G ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome Cell Stem Cell 2007;1:555–67 22 Mannello F Understanding breast cancer stem cell ... with a poor clinical outcome J Breast Cancer 2015;18:242–8 46 Ghebeh H, Sleiman GM, Manogaran PS, Al-Mazrou A, Barhoush E, AlMohanna FH, Tulbah A, Al-Faqeeh K, Adra CN Profiling of normal and malignant ... ALDH 1A1 , ALDH 1A3 , ALDH 3A1 , ALDH 4A1 , ALDH 6A1 , and ALDH 7A1 ), PROCR, and ITGA6/EpCAM In a medium cohort of patients in previous studies, these findings revealed that ALDH 1A3 , PROCR, ITGA6+, ITGA6+/EpCAM−...

Ngày tải lên: 17/06/2020, 16:57

... of astrocytoma migration and proliferation Int J cancerJournal Int du cancer 1996;67:275–82 38 Sakaue-Sawano A, Kurokawa H, Morimura T, Hanyu A, Hama H, Osawa H, Kashiwagi S, Fukami K, Miyata ... the bands were normalized to beta-actin internal standard using ImageJ Gel Analyze function Statistical analysis Experimental data are shown as mean ± standard error mean (SEM) Statistical analyses ... normal cells to ionizing radiation Semin Radiat Oncol 2007;17:81–8 Mantovani A, Allavena P, Sica A, Balkwill F Cancer-related inflammation Nature 2008;454:436–44 Lemay R, Archambault M, Tremblay...

Ngày tải lên: 21/09/2020, 01:33

... primer 5′ ​ - AGCTACAGC ATGATGCAGGA-3′​and reverse primer 5′​-GGTCATGGAGTTGTACTGCA-3′​), NANOG (sense primer 5′-​ TGAA CCTCAGCTACAAACAG -3′​and reverse primer 5′​-TGGTGGTAGGAAGAGTAAAG-3′​), TBP ... Conventional cytogenetic analyses revealed a CCR involving structural abnormalities of chromosomes and 12 The patient carried an abnormal chromosome 7, with an abnormally long short arm, and an abnormal ... 43 Madan, K., Nieuwint, A W & van Bever, Y Recombination in a balanced complex translocation of a mother leading to a balanced reciprocal translocation in the child Review of 60 cases of balanced...

Ngày tải lên: 04/12/2022, 14:53

... also may take a transcellular route through the body of the cell; see Carman and Springer [100] for a recent review of transcellular migration of cells Both transmigration paths are available ... 660–668 37 Kataoka N, Iwaki K, Hashimoto K, Mochizuki S, Ogasawara Y, Sato M, Tsujioka K & Kajiya F (2002) Measurements of endothelial cell- to -cell and cellto-substrate gaps and micromechanical properties ... chemical and mechanical Because the mechanical state of the endothelium is probably an important regulator of vascular homeostasis and leukocyte transmigration, many biophysical tools, such as AFM,...

Ngày tải lên: 22/03/2014, 21:20

... incubated with monoclonal antibodies against vascular cell adhesion molecule (VCAM)-1 (1: 100, Abcam, Cambridge, MA, USA), intercellular adhesion molecule (ICAM)-1 (1: 2000, Abcam, Cambridge, MA, ... USA) and heme oxygense (HO)-1 (1: 250, Abcam, Cambridge, MA, USA), and polyclonal antibodies against TNF -a (1: 1000, Cell Signaling, Danvers, MA, USA) and NFB (1: 250, Abcam, Cambridge, MA, USA) ... Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kawamata M, Kato T, Okochi H, Ochiya T: IFATS collection: in vivo therapeutic potential of human adipose tissue mesenchymal stem cells after transplantation...

Ngày tải lên: 18/06/2014, 22:20

... tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer Natasja K van den Engel1*†, Dominik Rüttinger1†, Margareta Rusan1, Robert Kammerer2, Wolfgang Zimmermann3, ... tumor cell vaccine combined with GM-CSF (a treatment strategy abbreviated as LRAST) Anti-tumor activity to subcutaneous tumor challenge was examined in a prophylactic as well as a therapeutic ... (Wiesbaden-Nordenstadt, Germany) Supernatants were analyzed in duplicate Extinction was analyzed at 405/490 nm on a TECAN microplate ELISA reader (TECAN, Crailsheim, Germany) with the EasyWin...

Ngày tải lên: 18/06/2014, 22:20

... autoantigen microarrays that contained more than 50 candidate SLE autoantigens. A table containing raw median pixel intensity minus background values for all array antigens is provided [see Additional ... PJU has served as a consultant to Cento- cor, Inc. (Horsham, PA, USA), Biogen Idec (Cambridge, MA, USA), Avanir Pharmaceuticals (Aliso Viejo, CA, USA), Amgen (Thousand Oaks, CA, USA), UCB (Brussels, ... 115:407-417. 8. Lau CM, Broughton C, Tabor AS, Akira S, Flavell RA, Mamula MJ, Christensen SR, Shlomchik MJ, Viglianti GA, Rifkin IR, Marshak- Rothstein A: RNA-associated autoantigens activate B cells by...

Ngày tải lên: 09/08/2014, 14:22

... microarray data J Am Stat Assoc 2005, 100:764-780 29 Ishwaran H, Rao JS, Kogalur UB: BAMarraytrade mark: Java software for Bayesian analysis of variance for microarray data BMC Bioinformatics ... Sherman BT Jr, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA: DAVID: Database for Annotation, Visualization, and Integrated Discovery Genome Biol 2003, 4:P3 22 Huang da W, Sherman BT, Lempicki RA: ... gene-dosage imbalance Am J Hum Genet 2007, 81:252-263 Nishiyama A, Xin L, Sharov AA, Thomas M, Mowrer G, Meyers E, Piao Y, Mehta S, Yee S, Nakatake Y, Stagg C, Sharova L, Correa-Cerro LS, Bassey...

Ngày tải lên: 09/08/2014, 20:22

... Bioinformatics 2009, 25:167-174 Yoshida-Hata N, Mitamura Y, Oshitari T, Namekata K, Harada C, Harada T, Yamamoto S: Transcription factor, SP1, in epiretinal membranes of patients with proliferative ... To be called a SNP, a locus had to have a coverage of at least eight reads, and a ratio between 0.5 and 0.6 for the major allele For each gene we calculated the probability that the major and minor ... Establishing, maintaining and modifying DNA methylation patterns in plants and animals Nat Rev Genet 2010, 11:204-220 Athanasiadou R, de Sousa D, Myant K, Merusi C, Stancheva I, Bird A: Targeting of...

Ngày tải lên: 09/08/2014, 23:20

... marrow—Transplantation—Handbooks, manuals, etc Hematopoietic stem cells—Transplantation—Handbooks, manuals, etc I Davison, Deborah Branney II Rust, Deborah M III Title [DNLM: Stem Cells—transplantation—handbooks ... predominately small cleaved cell Follicular mixed small cleaved and large cell Intermediate grade Follicular predominately large cell Diffuse small cleaved cell Diffuse mixed small cleaved and large ... HLA class I, HLA class II, and HLA class III E HLA class I antigens include HLA *A, HLA*B, and HLA*C genes and are found on all nucleated cells in the body Page 33 C There are four possible haplotype...

Ngày tải lên: 10/08/2014, 08:20

... and fractionated total body irradiation as a preparatory regimen for marrow transplantation in patients with advanced hematological malignancies: a phase I study Bone Marrow Transplant 1992;10:83–88 ... bone marrow transplantation Bone Marrow Transplant 1991;8:159–170 Thrombocytopenia Adams JA, Gordon AA, Jiang YZ, MacDonald D Thrombocytopenia after bone marrow transplantation for leukemia; changes ... transplantation for advanced malignant lymphoma Bone Marrow Transplant 1989;4:483–488 Cliff RA, Buckner CD, Thomas ED, et al Allogeneic marrow transplantation using fractionated total body irradiation...

Ngày tải lên: 10/08/2014, 08:20

... transplantation has been used in allogeneic transplantation for patients with a variety of disorders (e.g., malignancy, immunodeficiency disease, Fanconi's anemia) Advantages and disadvantages ... topical antibacterial and/or antifungal powders and/or ointments to axilla, groin, vaginal, and perirectal area Restrict visitation by children younger th age 12 Gastrointestinal, nonabsorbable ... perineal care Skin decontamination with antibacterial soap Meticulous central venous catheter site care Avoidance of procedures that risk hematogenous spread of bacteria from the gastrointestinal and...

Ngày tải lên: 10/08/2014, 08:20

... sinopulmonary Gram negatives (E Coli, P aeruginosa, Klebsiella) Gastrointestinal, blood, oral, perirectal Fungal: Candida species (C albican, glabratta krusei) Oral, esophageal, skin Aspergillus (fumagata, ... chills, malaise, night sweats Mycobacterium avium complex (MAC), hepatitis, CMV, tuberculosis (TB) Abdominal Hepatomegaly Hepatitis, CMV, MAC, toxoplasmosis Splenomegaly CMV, MAC Anorectal Anal pain/drainage ... also be sent for pathology, bacterial and fungal cultures, viral culture, immunofluorescent antibody, or rapid shell, silver slain, acid-fast bacteria, Mycoplasma, and Legionella Management a) ...

Ngày tải lên: 10/08/2014, 08:20

... are associated with decreased myocardial contractility, decreased cardiac output, and secondary pulmonary edema GVHD cardiac damage a) Usually associated with severe or hyperacute GVHD b) Features ... of bacterial endocarditis/myocarditis and coronary artery disease c) Symptoms are associated with decreased myocardial contractility, decreased cardiac output and secondary pulmonary edema, and ... transplant b) HLA-mismatched donor transplant c) Sex-matched transplant, with a female-to-male graft having increased incidence, especially with female donors who are multiparous or have had a...

Ngày tải lên: 10/08/2014, 08:20