start time machine at the command line

Mac Kung Fu pot

Mac Kung Fu pot

... beneath it, and you should type the entire line, hitting only at the end Usually you’ll be shown the command that activates the secret feature discussed in the tip, followed by the command that ... modifies various other keys The Shift keys, on the first-from-bottom row of the keyboard, at the left and right The keys sometimes feature the B symbol The Tab key, located to the left of the main QWERTY ... Using the Apple and Application Menus Some tips refer to the Apple menu Other tips refer to the application menu The Apple menu is the menu at the top left of the screen, signified appropriately...

Ngày tải lên: 06/03/2014, 20:20

318 5,6K 0
Once Its rationale, collective defense poses new challenge to a larger NATO

Once Its rationale, collective defense poses new challenge to a larger NATO

... the sea not operating under NATO command “Obviously, there are other NATO-affiliated nations out doing things,” Lt Col Web Wright, the spokesman, said “But I can’t speak for those nations.” The ... collective defense The famous Article of the NATO Charter stipulates that an attack on one NATO member is an attack on all, a principle that assured Western Europe during the cold war that America would ... in the NATO emergency meeting on Tuesday While the NATO statement did promise to consider the idea of beginning Georgia’s accession to NATO in December, the diplomat said that in reality, the...

Ngày tải lên: 19/07/2013, 16:34

35 308 0
The vocabulary builder : The Practically Painless Way to a Larger Vocabulary

The vocabulary builder : The Practically Painless Way to a Larger Vocabulary

... alleviate incinerate differentiate negotiate extrapolate obliterate postulate fluctuate formulate reiterate pullulate permeate simulate bifurcate manipulate speculate aberrate articulate precipitate ... different from what they mean separately Among the words in the lefthand column are ten idioms Circle the two words that aren't idioms, and then match them all with their closest synonyms in the right-hand ... critics charge that the movement is ultimately a pacifist one (a) largely, watery (b) in the end, appeasing (c) at last, thumbsucking (d) lately, prissy 20 The movement is still rather amorphous...

Ngày tải lên: 31/08/2013, 14:24

163 659 2
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx

Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx

... of the meat Heat the oil in a Dutch oven Brown the meat over moderately high heat on both sides Remove the meat from the pan and discard the pan fat Return the meat to the pan and turn the heat ... water Thus, they indicate that ordinary household tap water is fine for the diet One source notes that some water may include added iodine to eliminate bacteria and therefore that distilled water ... or the whole book and give them to others, provided that you include the ThyCa information at the bottom of each page Please not copy individual recipes or reproduce the recipes or other material...

Ngày tải lên: 22/03/2014, 16:21

123 392 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... cttgtacatatgagcgagaaaagcgaagaa cgttctcgagaatgaaaacattgattc gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG ... tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata ... gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al Journal of Translational Medicine...

Ngày tải lên: 18/06/2014, 16:20

9 568 0
Báo cáo hóa học: " Using Simulated Partial Dynamic Run-Time Reconfiguration to Share Embedded FPGA Compute and Power Resources across a Swarm of Unpiloted Airborne Vehicles" pdf

Báo cáo hóa học: " Using Simulated Partial Dynamic Run-Time Reconfiguration to Share Embedded FPGA Compute and Power Resources across a Swarm of Unpiloted Airborne Vehicles" pdf

... represent atomic operations These atomic operations then become states in a state machine Each time the machine transitions into a new state, the variables that make up the state of the application ... their own checkpointing allowing them to be restarted at that checkpoint even if reconfiguration is forced at an arbitrary time In cooperative checkpointing, the latency between when the operating ... in external memory The application performs processing within a loop At each iteration this state is updated At any point the application can thus be terminated When the application resumes execution...

Ngày tải lên: 22/06/2014, 22:20

12 392 0
Báo cáo khoa học: "Scaling Phrase-Based Statistical Machine Translation to Larger Corpora and Longer Phrases" pptx

Báo cáo khoa học: "Scaling Phrase-Based Statistical Machine Translation to Larger Corpora and Longer Phrases" pptx

... from the training data that occur in the NIST-2004 test set phrases times the average number of translations The number of words in the table is calculated as the number of unique phrases times the ... phrases of the specified length or greater The table shows the efficacy of using phrases of different lengths The table shows that while the rate of falloff is rapid, there are still multiple matches ... phrase-based machine translation does away with many of the problems associated with the original word-based formulation of statistical machine translation (Brown et al., 1993), in particular: • The Brown...

Ngày tải lên: 17/03/2014, 05:20

8 316 0
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx

Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx

... neither with regard to bleedings nor to death or MI With fondaparinux, there was however, the observation of clot formation on the catheters requiring additional UFH injections during PCI In the ... even at the cost of some time delay compared to fibrinolysis – it was unclear whether the combined strategy of fibrinolysis should be the option of choice (72) Later, it was shown that this strategy ... interest for the out-of hospital setting because of the simplicity of the application Mainly tenecteplase has been investigated with regard to this strategy (41, 66) All guidelines state that fibrinolytic...

Ngày tải lên: 18/06/2014, 12:20

12 323 1
Tài liệu The Time Machine pptx

Tài liệu The Time Machine pptx

... eye over the shoulder of the Medical Man, and he winked at me solemnly 14 The Time Machine II I think that at that time none of us quite believed in the Time Machine The fact is, the Time Traveller ... was the Medical Man, who rang the bell the Time Traveller hated to have servants waiting at dinner—for a hot plate At that the Editor turned to his knife and fork with a grunt, and the 18 The Time ... them when I saw their little pink hands feeling at the Time Machine Happily then, when it was not too late, I thought of a danger I had hitherto forgotten, and reaching over the bars of the machine...

Ngày tải lên: 21/02/2014, 14:20

120 548 0
Báo cáo khoa học: "Paraphrase Recognition Using Machine Learning to Combine Similarity Measures" ppt

Báo cáo khoa học: "Paraphrase Recognition Using Machine Learning to Combine Similarity Measures" ppt

... particular relation holds; the system locates in a document collection (or the entire Web) contexts were the seeds cooccur, and uses the contexts as patterns that can express the relation; the patterns ... 2006) Forward hill-climbing starts with an empty feature set, to which it adds features, one at a time, by preferring to add at each step the feature that leads to the highest predictive power ... irrelevant, increasing the risk of overfitting the training data Some features may also be redundant, given other features; thus, feature selection methods that consider the value of each feature on its...

Ngày tải lên: 08/03/2014, 01:20

9 402 0
Báo cáo khoa học: "Using Machine-Learning to Assign Function Labels to Parser Output for Spanish" ppt

Báo cáo khoa học: "Using Machine-Learning to Assign Function Labels to Parser Output for Spanish" ppt

... based on their phrasal category, the category of the mother node and their position relative to the local head In Spanish, the order of sentence constituents is flexible and their position relative ... number of trials) we calculate in how many cases the second method is better than the first (i.e the number of successes) We then perform the test with the null hypothesis that the probability of success ... the PRED attribute of the f-structure, GF is an LFG grammatical function attribute, and Pj is the value of the PRED attribute of the f-structure which is the value of the GF attribute This is done...

Ngày tải lên: 08/03/2014, 02:21

8 375 1
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

... is a rather far-reaching generalization of a theorem which proves the same result under the much stronger assumption that θ is of bounded type [P2] It is immediate from the definition that the class ... C by pull-back Note that the statement of this theorem is completely independent of the arithmetic of the rotation number θ Thus, with Theorem B in hand, it follows that Theorem A is true for ... with the surgery, they also proved a meta theorem asserting that Fθ and Pθ are quasiconformally conjugate if and only if fθ is quasisymmetrically conjugate to the rigid rotation Rθ on S1 QUADRATIC...

Ngày tải lên: 14/03/2014, 22:20

53 383 0
The time machine

The time machine

... Factsheets The Time Machine By H.G Wells Summary A group of men, including the narrator, are listening to the Time Traveller discuss his theories on time The Time Traveller produces a miniature Time Machine ... appears one week later (f) The Time Traveller first knows that his machine is working when he looks at the clock / his cook (g) The Time Traveller’s greatest fear is that his machine might stop ... would you in the Time Traveller’s situation? Would you be patient and learn to live in the new world, or would you try to find the time machine as soon as possible? Why? (c) What will the Time Traveller...

Ngày tải lên: 20/03/2014, 15:49

51 814 0
The Time Machine pot

The Time Machine pot

... And what was hidden down there, at the foot of that shaft? I sat upon the edge of the well telling myself that, at any rate, there was nothing to fear, and that there I must descend for the solution ... a clue to the import of these wells, to the ventilating towers, to the mystery of the ghosts; to say nothing of a hint at the meaning of the 40 bronze gates and the fate of the Time Machine! And ... perhaps across the spread of the waxen petals They grew scattered, as if wild, among the variegated shrubs, but, 22 as I say, I did not examine them closely at this time The Time Machine was left...

Ngày tải lên: 22/03/2014, 23:20

83 419 0
Báo cáo khoa học: "Using Machine Learning to Explore Human Multimodal Clarification Strategies" ppt

Báo cáo khoa học: "Using Machine Learning to Explore Human Multimodal Clarification Strategies" ppt

... only, i.e the turn containing the CR Context 3.2 Dialogue History Features The history features account for events in the whole dialogue so far, i.e all information gathered before asking the CR, ... model features” we consider features reflecting the wizards’ responsiveness to the be- Note that this feature is only an approximation of the ASR confidence score that we would expect in an automated ... chosen by at least two of the feature selection methods, i.e the features in the overlapping circle regions shown in figure For both data sets the highest ranking features are also the ones contained...

Ngày tải lên: 23/03/2014, 18:20

8 373 0
Báo cáo khoa học: "Using Machine Learning to Maintain Rule-based Named-Entity Recognition and Classification Systems" pdf

Báo cáo khoa học: "Using Machine Learning to Maintain Rule-based Named-Entity Recognition and Classification Systems" pdf

... categories, instead of the three categories used for the Greek experiment This differentiation originates in the fact that the French NERC system further categorises organisations into associations ... corpus The size of the gazetteers is rather small (3,059 names) At the partial matching sub-stage, classified names are matched against unclassified ones aiming at the recognition of the truncated ... classification of the rule-based system, while the columns to the classification of the system constructed by C4.5 Except from the problems identified in the recognition phase, the examination of the...

Ngày tải lên: 23/03/2014, 19:20

8 400 0
It is time for us to check in for our flight ppt

It is time for us to check in for our flight ppt

... đó) It is time for us to check in for our flight 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: It is time for us to check in for our flight 3 Tại câu lại dịch vậy? - “It is time – Đã ... *It is time for us to check in for our flight Hình thức cấu trúc ngữ pháp: “It’s time (for somebody) to something” - đến lúc người làm việc ... – thì, là, time – thời gian, lúc, thời điểm; trường hợp danh từ không đếm - “for us” – cho chúng ta; giới từ “us” – chúng tôi, chúng ta; đại từ nhân xưng tân ngữ giống “me / you/ them/ him/...

Ngày tải lên: 25/03/2014, 03:20

5 513 0
Báo cáo khoa học: "Applying Machine Learning to Chinese Temporal Relation Resolution" pptx

Báo cáo khoa học: "Applying Machine Learning to Chinese Temporal Relation Resolution" pptx

... indicators alone, the position of the punctuation mark separating the two clauses describing the events and the classes of the events are also useful classification attributes We will outline ... AFTER the second event Cases (2) and (3) are ambiguous The positions of the temporal indicators are the same But it is uncertain whether these indicators modify the first or the second event if there ... automate or at least semi-automate feature selection process An- other future work worth investigating is temporal indicator clustering There are two methods we could investigate, i.e clustering the...

Ngày tải lên: 31/03/2014, 03:20

7 276 0
Breaking the Time Barrier How to Unlock Your True Earning Potential

Breaking the Time Barrier How to Unlock Your True Earning Potential

... information I want to for the client is to help know the pain they might them explore what they be experiencing, the want.” problems they want to solve I’ll probe on what their dreams are, their ... insightful questions that demonstrate my expertise, which reassures the client that they’ve got someone in the room who can help them That relieves a lot of anxiety for them I had that experience myself ... at your prices through that lens, they merely want to know that the investment is a wise one That the return is going to justify the outlay And if there’s a wide margin between my price and the...

Ngày tải lên: 26/05/2014, 22:02

70 433 1
time machine 1 secret of the knights

time machine 1 secret of the knights

... huddled on the deck above the waves At dawn, the tide goes out, and the sailors groan at the sight of their ship The stern is caught on two big rocks The bow is already sunk beneath the sea The remaining ... raided the privateer is just a plain pirate! 7) The front of a ship is the bow; the back is the stern A small sail at the bow—called the foresail—is very important in steering the ship The main storerooms ... you an axe “Chop the ropes! Chop them all away!” You tie yourself to the stump of the mast and chop at the tangle of ropes until the mast is free The small foresail at the bow of the ship rips to...

Ngày tải lên: 31/05/2014, 01:29

130 447 0
w