standard template library in c tutorial pdf
Standard Template Library
Ngày tải lên :
12/09/2012, 22:55
... objects in
containers
Iterators provide access to objects in the
containers yet hide the internal structure of the
container
Slide 18- 17
Copyright © 2007 Pearson Education, Inc. Publishing ... Addison-Wesley
More Common Container Members
c. swap(other_container); // swaps contents of
// c and other_container.
c. push_back(item); // appends item to container c
c. begin( ); // returns ... destroys container, erases all
members
c. empty( ) // true if there are no entries in c
c. size( ) const; // number of entries in container c
c = v; //replace contents of c with contents...
- 56
- 447
- 0
Tài liệu Pro WPF in C# 2010 pdf
Ngày tải lên :
13/02/2014, 20:20
... Splash Screen 222
Handling Command-Line Arguments 223
Accessing the Current Application 224
Interacting Between Windows 225
Single-Instance Applications 227
Assembly Resources 234
Adding Resources ... 606
Change Notification 607
Binding to a Collection of Objects 609
Displaying and Editing Collection Items 610
Inserting and Removing Collection Items 614
Binding to the ADO.NET Objects 615 ...
Executing Commands 271
Command Sources 271
Command Bindings 272
Using Multiple Command Sources 275
Fine-Tuning Command Text 276
Invoking a Command Directly 276
Disabling Commands 277
Controls...
- 1.2K
- 10.5K
- 9
Tài liệu Thinking in C++ Second Edition pdf
Ngày tải lên :
22/12/2013, 00:17
... introduction to C than the chapter in this book, I have
created with Chuck Allison a CD ROM called “Thinking in C: foundations for Java and C+ +”
which will introduce you to the aspects of C ...
upcoming seminars can be found at
http://www.BruceEckel.com
. If you have specific
questions, you may direct them to
Bruce@EckelObjects.com
.
Chapter 1: Introduction to Objects 37
Casting ...
Preprocessor pitfalls 281
Macros and access 284
Inline functions 285
Inlines inside classes 285
Access functions 286
Stash & Stack with inlines 292
Inlines & the compiler 292
Limitations...
- 1.1K
- 853
- 9
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf
Ngày tải lên :
19/02/2014, 18:20
... 5¢-CTAGTCGTCCGAACTCCGATAATCGC
CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA
TGCCAAACGT TCGCGA CCGC CCTGAC GGCGAT TA
TCGGAGTTCGGACA-3¢ into the unique SpeI restriction
site. p13R4-DP was obtained by replacing the B10 tag of
the p13R4 construct ... sequence (amino acids
422–461 [18]). The B10 tag was subsequently added to the
resulting plasmid by cloning the following annealed oligo-
nucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC
CGTCAGGGCGGTCGCGAACGTTTAG-3¢ ... 5¢-ACTCATA
CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and
5¢-CCATCCGAATTCTCACTACACATTGAT CCTAGCA
GAAGC-3¢ were used for the PCR amplification of the
C- terminal region of d1-EGFP corresponding to the mouse
ornithine decarboxylase...
- 14
- 483
- 0
Data structures in c++ pdf
Ngày tải lên :
05/03/2014, 20:20
...
#include<iostream.h>
#include<conio.h>
#include<stdlib.h>
void check(char[]);
main(){clrscr();char s[100];
cin>>s;check(s);
getch();}
void check(char s[]){char c; int ...
#include<iostream.h>
#include<conio.h>
int size=10;
int a[10],top=-1;
int pop();
void r(int[]);
void push(int[],int);
main(){clrscr();int i,k;
for(i=0;i<size;i++){cin>>k;push(a,k);} ... اهو
9)
#include<iostream.h>
#include<conio.h>
int size=10;
int a[10],tail=-1,head=-1;
int p_q();
void add_q(int[],int);
void del(int[],int);
main(){clrscr();int i;
for(i=0;i<size;i++){if(tail==size-1){cout<<"...
- 68
- 462
- 2
Secure Coding in C and C++ pdf
Ngày tải lên :
08/03/2014, 11:20
... error processing but
then freed again in the normal course of events.
32
Leaking Containers in C+ +
In C+ +, standard containers that contain pointers do
not delete the objects to which the pointers ... management functions, it’s
important to keep them properly paired.
34
Dueling Containers in C+ +
vector<Shape *> pic;
pic.push_back( new Circle );
pic.push_back( new Triangle );
pic.push_back( new ... memory contain size information fields
both before and after the chunk, allowing
▪ two bordering unused chunks to be coalesced into one
larger chunk (minimizing fragmentation)
▪ all chunks...
- 135
- 4.6K
- 0
Developer''''s Guide to Microsoft Enterprise Library 5.0 C# Edition pdf
Ngày tải lên :
08/03/2014, 22:20
... application blocks, each aimed at managing specific
crosscutting concerns. In case this concept is unfamiliar, crosscutting concerns are those annoying
tasks that you need to accomplish in several ... dependencies
Application Block
Optional dependencies
Caching Block
May use the Data Access block to cache data in a database.
May use the Cryptography block to encrypt cached data.
Exception ... you can resolve the single instance of the concrete type using the following code.
IMyService myServiceInstance = theContainer.Resolve<IMyService>();
This returns an instance of the CustomerService...
- 229
- 1.3K
- 0
Thinking in C++, Volume 1, 2nd Edition pdf
Ngày tải lên :
08/03/2014, 23:20
... “seminar on CD ROM” titled
Thinking in C: Foundations for
Java & C+ +
by Chuck Allison (published by MindView, Inc., and
also available in quantities at
www.BruceEckel.com
). This contains ... files 110
Introducing
vector 112
Summary 118
Exercises 119
3: The C in C+ + 121
Creating
functions 122
Function return values 125
Using the C
function library 126
Creating your own ... with C+ +.”
Richard Hale Shaw
Contributing Editor, PC Magazine
28 Thinking in C+ + www.BruceEckel.com
Simula, as its name implies, was created for developing simulations
such as the classic “bank...
- 878
- 13K
- 2
Industry Standard Financial Statement - This Statement is for use in the MARP pdf
Ngày tải lên :
29/03/2014, 18:20
... specially-trained personnel in our offices and branches, including
specialised telephone contact points, to deal with customers facing or in
financial difficulties.
3. This Standard Financial Statement ...
Motor Insurance /Tax/NCT
C1 5
Rail/Bus/Taxi Costs (including school transport
costs for children)
C1 6
Car Maintenance/Repairs
C1 7
Car Parking and Tolls
Primary Residence ... /Oil
C3
Phone (Landline & Internet)
3
C4
TV/Cable
3
C5
Mobile Phone
C6
Refuse Charges
C7
TV Licence
Household
C8
Childcare
C9
Elderly care (e.g.,...
- 12
- 362
- 0
Báo cáo khoa học: Probing the access of protons to the K pathway in the Paracoccus denitrificans cytochrome c oxidase pdf
Ngày tải lên :
30/03/2014, 15:20
... dependent changes at the heme propionates in
cytochrome c oxidase from Paracoccus denitrificans:
direct evidence from FTIR difference spectroscopy in
combination with propionate
13
C labelling. Biochemistry
37, ... activity, kinetics of heme a
3
reduction and electrochemically induced FTIR differ-
ence spectroscopy. Based on the modest effects caused
by the mutations, it is concluded that in the Paracoc-
cus oxidase ... electrochemically induced FTIR
difference spectra of the corresponding cytochrome c
oxidases were recorded to detect molecular changes
concomitant with the redox reaction. This approach
allows monitoring...
- 9
- 367
- 0
Financial Applications Using Excel Add-in Development in C/C++ pdf
Ngày tải lên :
31/03/2014, 10:21
... Search and Replace or Paste Function dialogs 375
9.5 Accessing Excel functionality using COM/OLE automation using
C+ + 376
9.5.1 Initialising and un-initialising COM 377
9.5.2 Getting Excel to recalculate ... recalculate worksheets using COM 379
9.5.3 Calling user-defined commands using COM 380
9.5.4 Calling user-defined functions using COM 382
9.5.5 Calling XLM functions using COM 383
9.5.6 Calling ... compiled code resources.
Version 4 of Excel introduced macro sheets which could contain macros written in the
Excel macro language (XLM). These comprised columns of instructions and calculations
that...
- 587
- 4.7K
- 0
A TUTORIAL ON POINTERS AND ARRAYS IN C
Ngày tải lên :
05/04/2014, 01:21
... int N);
int compare(int *m, int *n);
int main(void)
{
42
CHAPTER 10: Pointers to Functions
Up to this point we have been discussing pointers to data objects. C also permits the
declaration ... *p, int width, int N,
int(*fptr)(const void *, const void *));
int compare_string(const void *m, const void *n);
int compare_long(const void *m, const void *n);
int main(void)
{
int ... object pointed to. (i.e. 2 for an integer, 4 for a
long, etc.).
Since a block of 10 integers located contiguously in memory is, by definition, an array of
integers, this brings up an interesting...
- 53
- 379
- 0
Báo cáo sinh học: " Experimental infection of H5N1 HPAI in BALB/c mice" pdf
Ngày tải lên :
18/06/2014, 18:20
... the chal-
lenge. Concentrations of the cytokine retained constant in
infected mice, except the unexpected decline occurred on
day 7. The expression of IL-18 could not be detected
throughout the ... [11]. PCR products were purified with the QIAquick
PCR purification (Qiagen).
Sequencing was done with Beckman Coulter Genom-
eLab™ Methods development kit Dye terminator Cycle
Sequencing according ... other Th1-cytokines (IFN-γ and IL-12).
Summing up, in our study BALB /c mice infected with
HPAI, strain A/duck/Tuva/01/06, appeared to be able to
produce the innate immune response, which culminated
to...
- 8
- 421
- 0
Báo cáo hóa học: " Evidence of structural genomic region recombination in Hepatitis C virus" pdf
Ngày tải lên :
20/06/2014, 01:20
... of Biochemistry and McGill Cancer Center, McGill University, Montreal, Quebec, H3G 1Y6,
Canada
Email: Juan Cristina* - cristina@cin.edu.uy; Rodney Colina - rcolina@cin.edu.uy
* Corresponding author ... source for generating genetic diversity in
natural populations of HCV, since a new intra-typic recombinant strain was found. Moreover, the
recombination break-points were found in the structural ... bootscaning, using putative recombinant sequence as a
query.
Results: Two crossing over events were identified in the E1/E2 structural region of an intra-typic
(1a/ 1c) recombinant strain.
Conclusion:...
- 8
- 247
- 0
