standard template library in c tutorial pdf
Standard Template Library
... objects in containers Iterators provide access to objects in the containers yet hide the internal structure of the container Slide 18- 17 Copyright © 2007 Pearson Education, Inc. Publishing ... Addison-Wesley More Common Container Members c. swap(other_container); // swaps contents of // c and other_container. c. push_back(item); // appends item to container c c. begin( ); // returns ... destroys container, erases all members c. empty( ) // true if there are no entries in c c. size( ) const; // number of entries in container c c = v; //replace contents of c with contents...
Ngày tải lên: 12/09/2012, 22:55
Exercise4. Inheritance, Polymorphism, and Virtual Functions Function Templates and the Standard Template Library
Ngày tải lên: 18/10/2013, 17:15
Tài liệu Pro WPF in C# 2010 pdf
... Splash Screen 222 Handling Command-Line Arguments 223 Accessing the Current Application 224 Interacting Between Windows 225 Single-Instance Applications 227 Assembly Resources 234 Adding Resources ... 606 Change Notification 607 Binding to a Collection of Objects 609 Displaying and Editing Collection Items 610 Inserting and Removing Collection Items 614 Binding to the ADO.NET Objects 615 ... Executing Commands 271 Command Sources 271 Command Bindings 272 Using Multiple Command Sources 275 Fine-Tuning Command Text 276 Invoking a Command Directly 276 Disabling Commands 277 Controls...
Ngày tải lên: 13/02/2014, 20:20
Tài liệu Thinking in C++ Second Edition pdf
... introduction to C than the chapter in this book, I have created with Chuck Allison a CD ROM called “Thinking in C: foundations for Java and C+ +” which will introduce you to the aspects of C ... upcoming seminars can be found at http://www.BruceEckel.com . If you have specific questions, you may direct them to Bruce@EckelObjects.com . Chapter 1: Introduction to Objects 37 Casting ... Preprocessor pitfalls 281 Macros and access 284 Inline functions 285 Inlines inside classes 285 Access functions 286 Stash & Stack with inlines 292 Inlines & the compiler 292 Limitations...
Ngày tải lên: 22/12/2013, 00:17
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf
... 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGT TCGCGA CCGC CCTGAC GGCGAT TA TCGGAGTTCGGACA-3¢ into the unique SpeI restriction site. p13R4-DP was obtained by replacing the B10 tag of the p13R4 construct ... sequence (amino acids 422–461 [18]). The B10 tag was subsequently added to the resulting plasmid by cloning the following annealed oligo- nucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ ... 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGAT CCTAGCA GAAGC-3¢ were used for the PCR amplification of the C- terminal region of d1-EGFP corresponding to the mouse ornithine decarboxylase...
Ngày tải lên: 19/02/2014, 18:20
Data structures in c++ pdf
... #include<iostream.h> #include<conio.h> #include<stdlib.h> void check(char[]); main(){clrscr();char s[100]; cin>>s;check(s); getch();} void check(char s[]){char c; int ... #include<iostream.h> #include<conio.h> int size=10; int a[10],top=-1; int pop(); void r(int[]); void push(int[],int); main(){clrscr();int i,k; for(i=0;i<size;i++){cin>>k;push(a,k);} ... اهو 9) #include<iostream.h> #include<conio.h> int size=10; int a[10],tail=-1,head=-1; int p_q(); void add_q(int[],int); void del(int[],int); main(){clrscr();int i; for(i=0;i<size;i++){if(tail==size-1){cout<<"...
Ngày tải lên: 05/03/2014, 20:20
Secure Coding in C and C++ pdf
... error processing but then freed again in the normal course of events. 32 Leaking Containers in C+ + In C+ +, standard containers that contain pointers do not delete the objects to which the pointers ... management functions, it’s important to keep them properly paired. 34 Dueling Containers in C+ + vector<Shape *> pic; pic.push_back( new Circle ); pic.push_back( new Triangle ); pic.push_back( new ... memory contain size information fields both before and after the chunk, allowing ▪ two bordering unused chunks to be coalesced into one larger chunk (minimizing fragmentation) ▪ all chunks...
Ngày tải lên: 08/03/2014, 11:20
Developer''''s Guide to Microsoft Enterprise Library 5.0 C# Edition pdf
... application blocks, each aimed at managing specific crosscutting concerns. In case this concept is unfamiliar, crosscutting concerns are those annoying tasks that you need to accomplish in several ... dependencies Application Block Optional dependencies Caching Block May use the Data Access block to cache data in a database. May use the Cryptography block to encrypt cached data. Exception ... you can resolve the single instance of the concrete type using the following code. IMyService myServiceInstance = theContainer.Resolve<IMyService>(); This returns an instance of the CustomerService...
Ngày tải lên: 08/03/2014, 22:20
Thinking in C++, Volume 1, 2nd Edition pdf
... “seminar on CD ROM” titled Thinking in C: Foundations for Java & C+ + by Chuck Allison (published by MindView, Inc., and also available in quantities at www.BruceEckel.com ). This contains ... files 110 Introducing vector 112 Summary 118 Exercises 119 3: The C in C+ + 121 Creating functions 122 Function return values 125 Using the C function library 126 Creating your own ... with C+ +.” Richard Hale Shaw Contributing Editor, PC Magazine 28 Thinking in C+ + www.BruceEckel.com Simula, as its name implies, was created for developing simulations such as the classic “bank...
Ngày tải lên: 08/03/2014, 23:20
Industry Standard Financial Statement - This Statement is for use in the MARP pdf
... specially-trained personnel in our offices and branches, including specialised telephone contact points, to deal with customers facing or in financial difficulties. 3. This Standard Financial Statement ... Motor Insurance /Tax/NCT C1 5 Rail/Bus/Taxi Costs (including school transport costs for children) C1 6 Car Maintenance/Repairs C1 7 Car Parking and Tolls Primary Residence ... /Oil C3 Phone (Landline & Internet) 3 C4 TV/Cable 3 C5 Mobile Phone C6 Refuse Charges C7 TV Licence Household C8 Childcare C9 Elderly care (e.g.,...
Ngày tải lên: 29/03/2014, 18:20
Báo cáo khoa học: Probing the access of protons to the K pathway in the Paracoccus denitrificans cytochrome c oxidase pdf
... dependent changes at the heme propionates in cytochrome c oxidase from Paracoccus denitrificans: direct evidence from FTIR difference spectroscopy in combination with propionate 13 C labelling. Biochemistry 37, ... activity, kinetics of heme a 3 reduction and electrochemically induced FTIR differ- ence spectroscopy. Based on the modest effects caused by the mutations, it is concluded that in the Paracoc- cus oxidase ... electrochemically induced FTIR difference spectra of the corresponding cytochrome c oxidases were recorded to detect molecular changes concomitant with the redox reaction. This approach allows monitoring...
Ngày tải lên: 30/03/2014, 15:20
Financial Applications Using Excel Add-in Development in C/C++ pdf
... Search and Replace or Paste Function dialogs 375 9.5 Accessing Excel functionality using COM/OLE automation using C+ + 376 9.5.1 Initialising and un-initialising COM 377 9.5.2 Getting Excel to recalculate ... recalculate worksheets using COM 379 9.5.3 Calling user-defined commands using COM 380 9.5.4 Calling user-defined functions using COM 382 9.5.5 Calling XLM functions using COM 383 9.5.6 Calling ... compiled code resources. Version 4 of Excel introduced macro sheets which could contain macros written in the Excel macro language (XLM). These comprised columns of instructions and calculations that...
Ngày tải lên: 31/03/2014, 10:21
A TUTORIAL ON POINTERS AND ARRAYS IN C
... int N); int compare(int *m, int *n); int main(void) { 42 CHAPTER 10: Pointers to Functions Up to this point we have been discussing pointers to data objects. C also permits the declaration ... *p, int width, int N, int(*fptr)(const void *, const void *)); int compare_string(const void *m, const void *n); int compare_long(const void *m, const void *n); int main(void) { int ... object pointed to. (i.e. 2 for an integer, 4 for a long, etc.). Since a block of 10 integers located contiguously in memory is, by definition, an array of integers, this brings up an interesting...
Ngày tải lên: 05/04/2014, 01:21
Báo cáo sinh học: " Experimental infection of H5N1 HPAI in BALB/c mice" pdf
... the chal- lenge. Concentrations of the cytokine retained constant in infected mice, except the unexpected decline occurred on day 7. The expression of IL-18 could not be detected throughout the ... [11]. PCR products were purified with the QIAquick PCR purification (Qiagen). Sequencing was done with Beckman Coulter Genom- eLab™ Methods development kit Dye terminator Cycle Sequencing according ... other Th1-cytokines (IFN-γ and IL-12). Summing up, in our study BALB /c mice infected with HPAI, strain A/duck/Tuva/01/06, appeared to be able to produce the innate immune response, which culminated to...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Evidence of structural genomic region recombination in Hepatitis C virus" pdf
... of Biochemistry and McGill Cancer Center, McGill University, Montreal, Quebec, H3G 1Y6, Canada Email: Juan Cristina* - cristina@cin.edu.uy; Rodney Colina - rcolina@cin.edu.uy * Corresponding author ... source for generating genetic diversity in natural populations of HCV, since a new intra-typic recombinant strain was found. Moreover, the recombination break-points were found in the structural ... bootscaning, using putative recombinant sequence as a query. Results: Two crossing over events were identified in the E1/E2 structural region of an intra-typic (1a/ 1c) recombinant strain. Conclusion:...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Research Article Bandwidth Optimization in Centralized WLANs for Different Traffic Types" pdf
Ngày tải lên: 22/06/2014, 19:20
