standard template library in c pdf

Standard Template Library

Standard Template Library

... objects in containers  Iterators provide access to objects in the containers yet hide the internal structure of the container Slide 18- 17 Copyright â 2007 Pearson Education, Inc. Publishing ... Addison-Wesley More Common Container Members  c. swap(other_container); // swaps contents of // c and other_container.  c. push_back(item); // appends item to container c  c. begin( ); // returns ... destroys container, erases all members  c. empty( ) // true if there are no entries in c  c. size( ) const; // number of entries in container c  c = v; //replace contents of c with contents...

Ngày tải lên: 12/09/2012, 22:55

56 448 0
Data structures in c++ pdf

Data structures in c++ pdf

... #include<iostream.h> #include<conio.h> #include<stdlib.h> void check(char[]); main(){clrscr();char s[100]; cin>>s;check(s); getch();} void check(char s[]){char c; int ... #include<iostream.h> #include<conio.h> int size=10; int a[10],top=-1; int pop(); void r(int[]); void push(int[],int); main(){clrscr();int i,k; for(i=0;i<size;i++){cin>>k;push(a,k);} ... اهو 9) #include<iostream.h> #include<conio.h> int size=10; int a[10],tail=-1,head=-1; int p_q(); void add_q(int[],int); void del(int[],int); main(){clrscr();int i; for(i=0;i<size;i++){if(tail==size-1){cout<<"...

Ngày tải lên: 05/03/2014, 20:20

68 462 2
Tài liệu The C++ Standard Library Second Edition pdf

Tài liệu The C++ Standard Library Second Edition pdf

... the libraries, of a C+ +98 program using a C+ +11 compiler should usually work. Linking code compiled using a C+ +11 compiler with code compiled using a C+ +98 compiler might fail. www.it-ebooks.info ptg7913098 2.2 ... ordered in quantity for bulk purchases or special sales, which may include electronic versions and/or custom covers and content particular to your business, training goals, marketing focus, and ... (std::set<X>& coll) { X x; // create an object of type X coll.insert(x); // insert it into the passed collection } Here, we insert a new object into a collection, which provides a member function that creates...

Ngày tải lên: 17/02/2014, 22:20

1,2K 8,5K 1
Tài liệu Thinking in C++ Second Edition pdf

Tài liệu Thinking in C++ Second Edition pdf

... introduction to C than the chapter in this book, I have created with Chuck Allison a CD ROM called “Thinking in C: foundations for Java and C+ +” which will introduce you to the aspects of C ... upcoming seminars can be found at http://www.BruceEckel.com . If you have specific questions, you may direct them to Bruce@EckelObjects.com . Chapter 1: Introduction to Objects 37 Casting ... Preprocessor pitfalls 281 Macros and access 284 Inline functions 285 Inlines inside classes 285 Access functions 286 Stash & Stack with inlines 292 Inlines & the compiler 292 Limitations...

Ngày tải lên: 22/12/2013, 00:17

1,1K 854 10
Tài liệu Pro WPF in C# 2010 pdf

Tài liệu Pro WPF in C# 2010 pdf

... Executing Commands 271 Command Sources 271 Command Bindings 272 Using Multiple Command Sources 275 Fine-Tuning Command Text 276 Invoking a Command Directly 276 Disabling Commands 277 Controls ... 606 Change Notification 607 Binding to a Collection of Objects 609 Displaying and Editing Collection Items 610 Inserting and Removing Collection Items 614 Binding to the ADO.NET Objects 615 ... Showing a Splash Screen 222 Handling Command-Line Arguments 223 Accessing the Current Application 224 Interacting Between Windows 225 Single-Instance Applications 227 Assembly Resources...

Ngày tải lên: 13/02/2014, 20:20

1,2K 10,5K 9
Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

... domain of GC -C, as described earlier [25]. Bound antibody was detected by enhanced chemiluminescence according to the manufacturer’s instructions. Immunofluorescence of Caco2 cells Immunocytochemistry ... analysis, which could account for the reduction in catalytic activity. In the current study, we have explored the phenomenon of the induction of cellular refractoriness to the ST peptide in Caco2 cells ... of cellular pathways in differentiating enterocytes [17]. GC -C has been cloned [18] and characterized from Caco2 cells [19], and Caco2 cells express lower levels of GC -C in comparison to T84 cells...

Ngày tải lên: 08/03/2014, 08:20

10 427 0
Secure Coding in C and C++ pdf

Secure Coding in C and C++ pdf

... processing but then freed again in the normal course of events. 32 Leaking Containers in C+ + In C+ +, standard containers that contain pointers do not delete the objects to which the pointers ... management functions, it’s important to keep them properly paired. 34 Dueling Containers in C+ + vector<Shape *> pic; pic.push_back( new Circle ); pic.push_back( new Triangle ); pic.push_back( new ... memory contain size information fields both before and after the chunk, allowing ▪ two bordering unused chunks to be coalesced into one larger chunk (minimizing fragmentation) ▪ all chunks...

Ngày tải lên: 08/03/2014, 11:20

135 4,6K 0
Thinking in C++, Volume 1, 2nd Edition pdf

Thinking in C++, Volume 1, 2nd Edition pdf

... “seminar on CD ROM” titled Thinking in C: Foundations for Java & C+ + by Chuck Allison (published by MindView, Inc., and also available in quantities at www.BruceEckel.com ). This contains ... files 110 Introducing vector 112 Summary 118 Exercises 119 3: The C in C+ + 121 Creating functions 122 Function return values 125 Using the C function library 126 Creating your own ... with C+ +.” Richard Hale Shaw Contributing Editor, PC Magazine 28 Thinking in C+ + www.BruceEckel.com Simula, as its name implies, was created for developing simulations such as the classic...

Ngày tải lên: 08/03/2014, 23:20

878 13K 2
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

... following prim- ers: 5Â-GCTTCAGCTGGGATCCGGTGGTATGGTGA G CAAGG-3Â; and 5Â-CCAGATCGCGGCCGCTTAGTGG TGATGATGGTGGTGATGATGCTTGTACAGCTCGT CC-3Â. Following the His 8 -tag, a TAA stop codon was inserted in ... primer, 5Â-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCAC GAA-3Â; 2.5T sense primer, 5Â-GCGCAAGCGCTTACG ACTTAAAAAAATTGGTCAGAAAATCCAGG-3Â; 2.5T antisense primer, 5Â-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense ... primers 5Â-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAG GAGC-3Â and 5Â-CCAGATCGCGGCCGCCTTGTACAG CTCGTCATGCCGAGAG-3Â; EcoRI and ApaI restriction enzyme sites were introduced into the 5Â-end and 3Â-end of the Cerulean DNA fragment....

Ngày tải lên: 30/03/2014, 04:20

16 329 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

... has recently been shown that the cysteine-rich domain of PC5 ⁄ 6A was responsible for membrane tethering, thus insuring cell-surface anchor- ing [37]. In other cases, the CT-peptide contains integ- ral ... enzymatic analysis, and purification of murine proprotein convertase-1 ⁄ 3 (PC1 ⁄ PC3) secreted from recombinant baculovirus-infected insect cells. Protein Expr Purif 14, 353–366. 8 Coates LC & ... that no conversion of prorenin into renin by PC1 ⁄ 3 could be observed in the constitutive secretory pathway of CHO cells, contrary to what is observed in secretory granules containing GH4 cells. Hence,...

Ngày tải lên: 30/03/2014, 08:20

10 305 0
Financial Applications Using Excel Add-in Development in C/C++ pdf

Financial Applications Using Excel Add-in Development in C/C++ pdf

... Search and Replace or Paste Function dialogs 375 9.5 Accessing Excel functionality using COM/OLE automation using C+ + 376 9.5.1 Initialising and un-initialising COM 377 9.5.2 Getting Excel to recalculate ... recalculate worksheets using COM 379 9.5.3 Calling user-defined commands using COM 380 9.5.4 Calling user-defined functions using COM 382 9.5.5 Calling XLM functions using COM 383 9.5.6 Calling ... compiled code resources. Version 4 of Excel introduced macro sheets which could contain macros written in the Excel macro language (XLM). These comprised columns of instructions and calculations that...

Ngày tải lên: 31/03/2014, 10:21

587 4,7K 0
Accelerate C in FPGA_7 pdf

Accelerate C in FPGA_7 pdf

... format specification in special circumstances. For example, a System.Double can contain special values that represent NaN (Not a Number), PositiveInfinity, or NegativeInfinity. In such cases, ... the num1 instance must be boxed in order to acquire a reference to the IComparable interface on it. Secondly, because CompareTo accepts a reference of type System.Object, the num2 instance must ... reference that points to the same object. Consider the following code: public class EntryPoint { static void Main() { object referenceA = new System.Object(); object referenceB = referenceA;...

Ngày tải lên: 20/06/2014, 08:20

59 246 0
Lập Trình C# all Chap "NUMERICAL RECIPES IN C" part 167 pdf

Lập Trình C# all Chap "NUMERICAL RECIPES IN C" part 167 pdf

... accuracy. Even though10 −7 can be represented accuratelyby itself, it cannot accurately be added to a much larger number. speaking, the machine accuracy  m is the fractional accuracy to which floating-point numbers ... problem in this particular case.) 1.3 Error, Accuracy, and Stability 31 Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge ... practical calculation is done with a finite, but sufficiently large, choice of that parameter. The discrepancy between the true answer and the answer obtained in a practical calculation is called...

Ngày tải lên: 01/07/2014, 09:20

4 317 0
w