standard template library in c pdf
Standard Template Library
Ngày tải lên :
12/09/2012, 22:55
... objects in
containers
Iterators provide access to objects in the
containers yet hide the internal structure of the
container
Slide 18- 17
Copyright â 2007 Pearson Education, Inc. Publishing ... Addison-Wesley
More Common Container Members
c. swap(other_container); // swaps contents of
// c and other_container.
c. push_back(item); // appends item to container c
c. begin( ); // returns ... destroys container, erases all
members
c. empty( ) // true if there are no entries in c
c. size( ) const; // number of entries in container c
c = v; //replace contents of c with contents...
- 56
- 447
- 0
Data structures in c++ pdf
Ngày tải lên :
05/03/2014, 20:20
...
#include<iostream.h>
#include<conio.h>
#include<stdlib.h>
void check(char[]);
main(){clrscr();char s[100];
cin>>s;check(s);
getch();}
void check(char s[]){char c; int ...
#include<iostream.h>
#include<conio.h>
int size=10;
int a[10],top=-1;
int pop();
void r(int[]);
void push(int[],int);
main(){clrscr();int i,k;
for(i=0;i<size;i++){cin>>k;push(a,k);} ... اهو
9)
#include<iostream.h>
#include<conio.h>
int size=10;
int a[10],tail=-1,head=-1;
int p_q();
void add_q(int[],int);
void del(int[],int);
main(){clrscr();int i;
for(i=0;i<size;i++){if(tail==size-1){cout<<"...
- 68
- 462
- 2
Tài liệu The C++ Standard Library Second Edition pdf
Ngày tải lên :
17/02/2014, 22:20
... the
libraries, of a C+ +98 program using a C+ +11 compiler should usually work. Linking code compiled
using a C+ +11 compiler with code compiled using a C+ +98 compiler might fail.
www.it-ebooks.info
ptg7913098
2.2 ... ordered in quantity for bulk purchases or
special sales, which may include electronic versions and/or custom covers and content particular to
your business, training goals, marketing focus, and ... (std::set<X>& coll)
{
X x; // create an object of type X
coll.insert(x); // insert it into the passed collection
}
Here, we insert a new object into a collection, which provides a member function that creates...
- 1.2K
- 8.5K
- 1
Tài liệu Thinking in C++ Second Edition pdf
Ngày tải lên :
22/12/2013, 00:17
... introduction to C than the chapter in this book, I have
created with Chuck Allison a CD ROM called “Thinking in C: foundations for Java and C+ +”
which will introduce you to the aspects of C ...
upcoming seminars can be found at
http://www.BruceEckel.com
. If you have specific
questions, you may direct them to
Bruce@EckelObjects.com
.
Chapter 1: Introduction to Objects 37
Casting ...
Preprocessor pitfalls 281
Macros and access 284
Inline functions 285
Inlines inside classes 285
Access functions 286
Stash & Stack with inlines 292
Inlines & the compiler 292
Limitations...
- 1.1K
- 853
- 9
Tài liệu Pro WPF in C# 2010 pdf
Ngày tải lên :
13/02/2014, 20:20
...
Executing Commands 271
Command Sources 271
Command Bindings 272
Using Multiple Command Sources 275
Fine-Tuning Command Text 276
Invoking a Command Directly 276
Disabling Commands 277
Controls ... 606
Change Notification 607
Binding to a Collection of Objects 609
Displaying and Editing Collection Items 610
Inserting and Removing Collection Items 614
Binding to the ADO.NET Objects 615 ...
Showing a Splash Screen 222
Handling Command-Line Arguments 223
Accessing the Current Application 224
Interacting Between Windows 225
Single-Instance Applications 227
Assembly Resources...
- 1.2K
- 10.5K
- 9
Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf
Ngày tải lên :
08/03/2014, 08:20
... domain of
GC -C, as described earlier [25]. Bound antibody was
detected by enhanced chemiluminescence according to the
manufacturer’s instructions.
Immunofluorescence of Caco2 cells
Immunocytochemistry ... analysis, which could
account for the reduction in catalytic activity.
In the current study, we have explored the phenomenon
of the induction of cellular refractoriness to the ST peptide
in Caco2 cells ... of
cellular pathways in differentiating enterocytes [17]. GC -C
has been cloned [18] and characterized from Caco2 cells
[19], and Caco2 cells express lower levels of GC -C in
comparison to T84 cells...
- 10
- 427
- 0
Secure Coding in C and C++ pdf
Ngày tải lên :
08/03/2014, 11:20
... processing but
then freed again in the normal course of events.
32
Leaking Containers in C+ +
In C+ +, standard containers that contain pointers do
not delete the objects to which the pointers ... management functions, it’s
important to keep them properly paired.
34
Dueling Containers in C+ +
vector<Shape *> pic;
pic.push_back( new Circle );
pic.push_back( new Triangle );
pic.push_back( new ... memory contain size information fields
both before and after the chunk, allowing
▪ two bordering unused chunks to be coalesced into one
larger chunk (minimizing fragmentation)
▪ all chunks...
- 135
- 4.6K
- 0
Thinking in C++, Volume 1, 2nd Edition pdf
Ngày tải lên :
08/03/2014, 23:20
... “seminar on CD ROM” titled
Thinking in C: Foundations for
Java & C+ +
by Chuck Allison (published by MindView, Inc., and
also available in quantities at
www.BruceEckel.com
). This contains ... files 110
Introducing
vector 112
Summary 118
Exercises 119
3: The C in C+ + 121
Creating
functions 122
Function return values 125
Using the C
function library 126
Creating your own ... with C+ +.”
Richard Hale Shaw
Contributing Editor, PC Magazine
28 Thinking in C+ + www.BruceEckel.com
Simula, as its name implies, was created for developing simulations
such as the classic...
- 878
- 13K
- 2
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf
Ngày tải lên :
30/03/2014, 04:20
... following prim-
ers: 5Â-GCTTCAGCTGGGATCCGGTGGTATGGTGA G
CAAGG-3Â; and 5Â-CCAGATCGCGGCCGCTTAGTGG
TGATGATGGTGGTGATGATGCTTGTACAGCTCGT
CC-3Â. Following the His
8
-tag, a TAA stop codon was
inserted in ... primer,
5Â-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCAC
GAA-3Â; 2.5T sense primer, 5Â-GCGCAAGCGCTTACG
ACTTAAAAAAATTGGTCAGAAAATCCAGG-3Â; 2.5T
antisense primer, 5Â-CCTGGATTTTCTGACCAATTTTT
TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense ... primers
5Â-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAG
GAGC-3Â and 5Â-CCAGATCGCGGCCGCCTTGTACAG
CTCGTCATGCCGAGAG-3Â; EcoRI and ApaI restriction
enzyme sites were introduced into the 5Â-end and 3Â-end of
the Cerulean DNA fragment....
- 16
- 329
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
Ngày tải lên :
30/03/2014, 08:20
... has recently been shown that the
cysteine-rich domain of PC5 ⁄ 6A was responsible for
membrane tethering, thus insuring cell-surface anchor-
ing [37]. In other cases, the CT-peptide contains integ-
ral ... enzymatic analysis, and purification of
murine proprotein convertase-1 ⁄ 3 (PC1 ⁄ PC3) secreted
from recombinant baculovirus-infected insect cells.
Protein Expr Purif 14, 353–366.
8 Coates LC & ... that no conversion of prorenin into
renin by PC1 ⁄ 3 could be observed in the constitutive
secretory pathway of CHO cells, contrary to what is
observed in secretory granules containing GH4 cells.
Hence,...
- 10
- 305
- 0
Financial Applications Using Excel Add-in Development in C/C++ pdf
Ngày tải lên :
31/03/2014, 10:21
... Search and Replace or Paste Function dialogs 375
9.5 Accessing Excel functionality using COM/OLE automation using
C+ + 376
9.5.1 Initialising and un-initialising COM 377
9.5.2 Getting Excel to recalculate ... recalculate worksheets using COM 379
9.5.3 Calling user-defined commands using COM 380
9.5.4 Calling user-defined functions using COM 382
9.5.5 Calling XLM functions using COM 383
9.5.6 Calling ... compiled code resources.
Version 4 of Excel introduced macro sheets which could contain macros written in the
Excel macro language (XLM). These comprised columns of instructions and calculations
that...
- 587
- 4.7K
- 0
Accelerate C in FPGA_7 pdf
Ngày tải lên :
20/06/2014, 08:20
... format specification in special circumstances.
For example, a System.Double can contain special values that represent NaN (Not a Number),
PositiveInfinity, or NegativeInfinity. In such cases, ... the num1 instance
must be boxed in order to acquire a reference to the IComparable interface on it. Secondly, because
CompareTo accepts a reference of type System.Object, the num2 instance must ... reference that points to the same object. Consider the following code:
public class EntryPoint
{
static void Main()
{
object referenceA = new System.Object();
object referenceB = referenceA;...
- 59
- 246
- 0
Lập Trình C# all Chap "NUMERICAL RECIPES IN C" part 167 pdf
Ngày tải lên :
01/07/2014, 09:20
... accuracy. Even though10
−7
can be represented accuratelyby itself, it cannot
accurately be added to a much larger number.
speaking, the machine accuracy
m
is the fractional accuracy to which floating-point
numbers ... problem in this particular case.)
1.3 Error, Accuracy, and Stability
31
Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5)
Copyright (C) 1988-1992 by Cambridge ... practical calculation is done with a finite, but
sufficiently large, choice of that parameter.
The discrepancy between the true answer and the answer obtained in a practical
calculation is called...
- 4
- 317
- 0