ss practice with a partner in c4
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
Ngày tải lên :
20/02/2014, 01:20
... Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteome; and (c) by examining glutamine incorporation into ... basolaterally administered glutamine led to a time-dependent increase of label in the cells with a maximum at 24 h, after which a steady state level was reached Remarkably, an increase of radioactivity ... cytoplasmic proteins that can bind to the membrane surface in response to elevations in intracellular calcium [45] Annexin A2 is an F-actin binding protein and participates in the formation of...
- 15
- 506
- 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt
Ngày tải lên :
06/03/2014, 08:21
... This can be interpreted as the assertion that the conditional probability that a random integer has exactly divisor in (y, 2y] given that it has at least one divisor in (y, 2y], tends to zero as ... The author also thanks G´rald Tenenbaum for several preprints of his work and for informe ing the author about the theorem of Rogers mentioned above, and thanks INTEGERS WITH A DIVISOR IN AN INTERVAL ... conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy of Sciences Finally, the author...
- 68
- 409
- 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
Ngày tải lên :
16/03/2014, 12:20
... Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC ... TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC ... 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢ (Trp551 fi Ala), 5¢-GTTGCTGTTAGCCTGAACCCAC GAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAA CCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTGTTA GCCTGAACCGCCGAT (Trp551 fi Ala ⁄ Phe554 fi Ala)...
- 15
- 337
- 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
Ngày tải lên :
01/06/2014, 10:54
... English years years years years Social Studies years years years years Math* years years years years Lab Science** years years years years Foreign Language years years years years Academic Electives ... many complicated tasks involved in the admission process Some are perfectly appropriate for parents, such as finding out about deadlines, arranging for visits, and helping gather information But ... THE ESSAY OR PERSONAL STATEMENT The personal essay allows each applicant to help admission officers read the map more accurately In addition to speaking of your goals, dreams, and expectations,...
- 142
- 375
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
Ngày tải lên :
19/06/2014, 08:20
... either a ballistic or a ramp pinch task, an increase in force and acceleration, associated with an increase in MEP amplitude, was observed in the muscle involved in the training, but not in a muscle ... acquisition and learning are associated with an increase in target muscle cortical excitability and a modulation of intracortical inhibition, but the relationship of cortical excitability changes with ... Boston, MA, USA 4MIT, Boston, MA, USA 5Institut Guttmann, Universitat Autonoma de Barcelona, Barcelona, Spain 6Laboratory of Neuromodulation, Spaulding Rehabilitation Hospital, Harvard Medical School,...
- 8
- 432
- 0
Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx
Ngày tải lên :
22/06/2014, 22:20
... Riemannian p-homogeneous forms; we define a suitable notion of Kato class of measures We assume that the potential is a measure in the Kato class and we prove a Harnack inequality (on balls that are ... Matematica “Francesco Brioschi”, Politecnico di Milano, Piazza Leonardo Da Vinci 32, Italy; Accademia Nazionale delle Scienze detta dei XL, Via L Spallanzani 7, Italy Email address: marbir@mate.polimi.it ... was initially given by Kato [16] in the case of Laplacian and extended in [2] to the case of elliptic operators with bounded measurable coefficients Kato classes relative to a subelliptic Laplacian...
- 19
- 326
- 0
A Woman with a mass in the liver pot
Ngày tải lên :
13/07/2014, 20:20
... neuroendocrine carcinoma chạy tới gan, ch a dùng chemotherapy agents mà thường dùng cho ch a ung thư thấy phổi, tức dùng combination Carboplatin etoposide "first line" - Kinh nghiệm "small cell cancer ... differentiated: carcinoid tumor hay pancreatic endocrine tumor (b) poorly differentiated có lẽ từ phổi (small cell cancer) Case khó chỗ: (1) tìm poorly diff neuroendocrine carcinoma, tức thuộc small cell ... (cecal mass) hay: thấy villous adenoma cắt sâu thấy chuyển sang poorly diff neuroendocrine carcinoma Tức : poorly diff neuroendocrine tumor từ cecum chạy tới gan (2) Bây xác nhận neuroendocrine...
- 4
- 249
- 0
Báo cáo lâm nghiệp: "Productivity and cost of manual felling with a chainsaw in Caspian forests" pptx
Ngày tải lên :
07/08/2014, 10:21
... Conduct a continuous time study on manual harvesting systems with a chainsaw model Stihl in a Caspian hardwood forest (2) Estimate the production rates and costs of chainsaw felling Material and ... Fagus orientalis, Carpinus betulus, Acer velutinum, Alnus subcordata and Ulmus glabra The canopy height averages approximately 26 m The manual harvesting system examined consisted of felling with ... Silvicultural system Kind of timber selection cutting beech, alder 97 Table Statistics of operational variables of the chainsaw felling in the study area Standard Variable mean deviation minimum maximum...
- 5
- 393
- 0
Báo cáo y học: "Tight perioperative glucose control is associated with a reduction in renal impairment and renal failure in non-diabetic cardiac surgical patients" ppsx
Ngày tải lên :
13/08/2014, 11:23
... outcome: any surgery or invasive procedure necessary to treat a postoperative adverse event associated with the initial cardiac surgery Statistical analysis Uni- and multivariate analysis for assessment ... Tripathy D, Garg R, Bandyopadhyay A, Calieri J, Hoffmeyer D, Syed T, Ghanim H, Aljada A, Dandona P: Anti-inflammatory and pro-fibrinolytic effect of insulin in acute ST-elevation myocardial infarction ... level at induction of anesthesia, on the initiation of cardiopulmonary bypass, at rewarming to normothermia on CPB, at separating from bypass, at admission in the ICU and after 12, 24, 36 and 48...
- 12
- 245
- 0
promoting truth-telling (the concept and its practice) with effective communication in medical settings
Ngày tải lên :
22/12/2014, 16:53
... diagnosed a cancerous growth in the bladder, but he pleaded that he did so after a careful manual and visual examination of the bladder and after taking all steps reasonable and practicable in ... sustaining treatment I examine qualitative research as well as quantitative research into these practices, as published in major journals and books both in Japanese and in English The chapter ... case of Dr Yamazaki‟s patient ………………………………………………… 129 Good practice regarding truth-telling in medical settings in Japan …………………… 136 The practice of withholding and withdrawing life sustaining...
- 229
- 1.3K
- 0
Nonlinear vibration of a pendulum with a support in harmonic motion
Ngày tải lên :
08/04/2015, 15:30
... the case when differs a little from unity We are interested in finding out what happens close to resonance, that is to say when - is sm all, namely: - (5) = + (Jjd where A is a detuning parameter ... h e sta tio n a r y am p litu d e a and phase rjo are determ ined by hi~ia + C~I2 sin rjo = 0, ~ a U JẨ ( 11) + ~ a ị + C~12 cos r?o = A sim p le c a lc u la tio n elim in atin g T leads to ... tin g here ỉ/ = l / y / ã we have (28) — = a y /a + ( \ / a • a 3) We shall consider the principal reson ant case w h en the am plitude a takes values close to aQ d ete r m in e d by n £2 i/(a...
- 9
- 337
- 0
What can i do with a degree in Film
Ngày tải lên :
05/12/2016, 21:34
... fund-holding manager - Doctors’ surgery Box Office Assistant (x2) - Sundance Film Festival, V &A Museum Business Manager - Barclays Campaign Co-ordinator - Unison Media Cataloguer - East Anglian Film Archive ... Business and customer awareness Integrity Capacity to develop Drive and resilience IT skills Enterprise Enthusiasm/passion Planning and organisation Maturity What is a career? • Not necessarily ... Archivist • Arts Administrator • Cinema Manager • Editorial Assistant • Film/Video Producer • Information Assistant • Journalist • Librarian, Special/Academic • Media Planner • Picture Researcher • Presenter...
- 50
- 386
- 0
Báo cáo y học: " Diagnosing asthma in general practice with portable exhaled nitric oxide measurement – results of a prospective diagnostic study" ppsx
Ngày tải lên :
12/08/2014, 14:20
... bronchial provocation test with methacholine in asthma A Bayesian analysis approach Chest 1993, 104:149-154 Wilson EB: Probable inference, the law of succession, and statistical inference J Am Stat ... non-smoking patients initially labelled as COPD or overlap were classified as asthma patients with fixed airway obstruction This might attenuate the potential limitation, in particular as this ... analyzer seems to be effective for ruling in and ruling out asthma in general practice Asthma could be ruled in satisfyingly with a cut-off at FENO > 46 ppb Mild and moderate to severe asthma...
- 11
- 354
- 0
Báo cáo y học: " ''''Diagnosing Asthma in General Practice with Portable Exhaled Nitric Oxide Measurement – Results of a " pps
Ngày tải lên :
12/08/2014, 14:20
... line 4, "81%" should say "82%" and in line 5, "FENO £12" should say "FENO £16" In the second paragraph, in line 1, "five" should say "three" In line 5, "16 patients had FENO £12 ppb" should say ... £12 ppb" should say "FENO £16 ppb" and "five" should say "three" In line "12 ppb" should say "16 ppb" The sentence starting in line and ending in line should read: "Sensitivity was 78% (95%CI 63–89), ... Tilemann L, Schermer T, Gindner L, Laux G, Szecsenyi J, Meyer FJ: Diagnosing asthma in general practice with portable exhaled nitric oxide measurement – results of a prospective diagnostic study Respir...
- 3
- 198
- 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
Ngày tải lên :
25/10/2012, 11:40
... hematological investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission ... if in varying degrees, makes the Authors believe in an autosomic dominant transmission of the character, in consideration of the vertical and gender-independent transmission The present case also ... prematurely intercept a clinical picture of hyperdontia is important also for the possible association of this anomaly with ingravescent syndromic forms 10,11; in order to make an early diagnosis...
- 7
- 597
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
Ngày tải lên :
26/10/2012, 09:07
... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... interventions in managing chronic spinal pain Pain Physician 2009; 12: E71-120 Manchikanti L, Singh V, Pampati V, et al Is there correlation of facet joint pain in lumbar and cervical spine? Pain Physician ... previously painful movements.9-11,32 Materials and Methods The study was conducted at an interventional pain management practice, a specialty referral center, in a private practice setting in the...
- 12
- 669
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
Ngày tải lên :
03/11/2012, 10:52
... (HRP–conjugated anti–rabbit IgG, Santa Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human ... complex was precipitated with 100 µl of goat anti rabbit IgG and 10 µl of normal rabbit serum (Peninsula Laboratories Inc., San Carlos, CA) dissolved in RIA buffer After incubating at room temperature ... content in the CSF and serum precedes ALS-type motor impairment assessed by rotarod assay In A, ALS-type muscle weakness in mutant G9 3A SOD-1 as a function of clinical progression (age) In B,C,...
- 8
- 499
- 0