ss complete the sentences using a or an

... Table provides summary statistics by year for corporate governance scorecard This table reports the mean, median, standard deviation, minimum, and maximum of corporate governance scores for the ... more than times in the year? Did the NC meet more than times in the year? Was the attendance at NC meetings more than 60%? Was the attendance at NC meetings more than 80%? Was the attendance at NC ... 70.00 69.00 69.00 69.00 69.00 n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a 82.00 81.00 77.00 73.00 73.00...

Ngày tải lên: 06/01/2015, 19:48

... (r) for non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting ... Acknowledgements The authors thank to ệzay Akan, Yeim ầetinkaya ardan, Gỹlen Hasỗelik, Deniz Gỹr, Frdevs Akta, Dilek Arman, Nedim Sultan, Bỹlent Beirbelliolu and Esra Karakoỗ for their kindness in data collection ... G, Markogiannakis A, Papaparaskevas J, Daikos GL, Stefanakos G, Zissis NP, Avlamis A Differences in the changes in resistance patterns to third- and fourth-generation cephalosporins and piperacillin/tazobactam...

Ngày tải lên: 25/10/2012, 11:00

... their merchants penetrated the interior of Europe and Asia Caravan roads extended south to Arabia and east to Mesopotamia and Armenia, penetrating the whole Orient as far as India, and even the frontiers ... from the Atlantic to the Euphrates, a distance of more than three thousand miles, and from the Danube and the English Channel to the cataracts of the Nile and the Desert of Sahara Its population ... highways started from Rome, viz.: the Via Appia and Latina to the south; two, Valeria and Salaria, to the Adriatic; two, Cassia and Aurelia, to the northwest; and the Via Æmilia, serving for both...

Ngày tải lên: 17/02/2014, 02:20

... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... membranes Anti-HA and anti-porin sera were used at : 5000 dilution whereas the anti-MWFE and anti-18 kDa sera were used at : 1000 dilution Horseradish peroxidase-conjugated secondary antibodies (anti-rabbit ... vectors such that either the HA or the HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢...

Ngày tải lên: 19/02/2014, 16:20

... D307/31 8A, and the double mutants E55/7 1A- Q58/7 4A, E55/7 1A- D307/31 8A and Q58/7 4A- D307/31 8A In addition, D299/31 0A was incompletely protected by Mab-1 Mab-1 and PAI-1 latency transition and PAI-1 inactivation ... (Molndal, ¨ Sweden) Human urokinase-type plasminogen activator (uPA) was from Wakamoto Pharmacautical Co (Tokyo, Japan) XR5118 was a kind gift from Dr Thomas Frandsen, Finsen Laboratory, Copenhagen ... K.W & Andreasen, P .A (1996) Conformational changes of the reactive-centre loop and b-strand 5A accompany temperature-dependent inhibitor-substrate transition of plasminogen-activator inhibitor Eur...

Ngày tải lên: 20/02/2014, 11:20

... that available in the DD350 data As mentioned above, DD350 transactions have missing and incorrect as well as inadequate data Many of these errors and anomalies, such as the wrong coding of a ... Contracting Science Applications International Corporation Service Contract Act Small or Disadvantaged Business Securities and Exchange Commission Standard Industrial Classification Space and Missile ... to Carol Zaremba for handling all the administrative details of publication Last, we thank Susan Gates for her formal review and suggestions for improvement xiii ACRONYMS A& AS AAC ABSS ADP ADPE...

Ngày tải lên: 06/03/2014, 16:20

... C are treated as the random factor in a repeated measures design since each BfC contributes a score for each metric Then, the classification rates for Mx and My on the BfCs are compared with each ... still be appropriate for other tasks, such as anaphora resolution.) Discussion: the performance of M.NOCB We already saw that Poesio et al (2004) found that the majority of the recorded transitions ... Workshop on NLG, pages 98–107, Niagara-on-theLake, Ontario, Canada Eleni Miltsakaki 2002 Towards an aposynthesis of topic continuity and intrasentential anaphora Computational Linguistics, 28(3):319–355...

Ngày tải lên: 17/03/2014, 06:20

... resistance mechanisms that are similar for both triclosan and antibiotics.40 Triclosan does not actually cause a mutation in the bacteria, but by killing the normal bacteria, it creates an environment ... triclosan, issued to the Colgate-Palmolive Company for antibacterial soap bars Over the next decade, other soaps, disinfectants, deodorants, shampoos, and medical supplies, all containing triclosan ... Helene® Tea Trea Oil Deodorant and Aloe Deodorant; Nature De France Le Stick Natural Stick Deodorant; DeCleor Deodorant Stick; Epoch® Deodorant with Citrisomes; X Air Maximum Strength Deodorant OTHER...

Ngày tải lên: 23/03/2014, 10:20

... dithionite was added gradually to the verdohaem complex under anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum ... (Iwatani, Fukuoka, Japan) All other chemicals used were of analytical grade Formation of a- hydroxyhaem-rHO-1 complex Scheme The resonance structure of a- hydroxyhaem Unless otherwise stated, the ... Matera et al [26]; the optical spectrum of the ferric form exhibited a rather broad Soret band, whereas the Soret bands of the ferrous and ferrous-CO forms were narrow (Fig 1B) The ratios of the...

Ngày tải lên: 23/03/2014, 21:20

... AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT ... AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC ... AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA...

Ngày tải lên: 30/03/2014, 11:20

... media explained that Moe had been an orphan brought back by the Davis family from a vacation in Africa The story didn’t share that almost all baby chimps acquired from Africa are orphans As with ... the American Humane Association, which monitors movie sets A Los Angeles Daily News article noted that the Screen Actors Guild of Hollywood funds the American Humane Association, and quoted animal ... less facial hair and what is considered to be a more human-shaped head than most chimps He was sold by the Burgers to another trainer and toured Japan, smoking cigars, drinking whisky, and sleeping...

Ngày tải lên: 30/03/2014, 14:20

... low-impedance (resistance and inductance) connections to power and ground and to provide easy access to power and ground at any location on the board Plane layers and impedance issues are discussed ... time and cost because they allow designs to be simulated and analyzed prior to purchasing and manufacturing hardware Once a design has been proven through drawings, simulations, and analysis, the ... concepts and IPC’s courtyard concepts To aid in understanding the design issues, manufacturing processes such as reflow and wave soldering, pick-and-place assembly, and thermal management are discussed...

Ngày tải lên: 07/04/2014, 22:14

... handleRequest(‘math’,new Array(‘+’)); =} The math command is passed as the first parameter, and an array containing the single character + is passed as the second parameter Using an array as the second parameter ... understand them or don’t know what they are To understand them, here is an analogy: Imagine a large crowd of people, and two people in the crowd are Alma and John They know each other, and Alma knows ... of the message In addition, the message parts and the values passed with them are linked together by the colon character (:) Each message part can have a maximum of one parameter associated with...

Ngày tải lên: 28/04/2014, 16:15

... men did a don't b as c to d did > d 266 A Suez Canal connects the Mediterranean Sea and the Gulf of Suez and separates the continents of Africa and Asia a A b connects c separates d of > a 267 ... of the words are the same in American and in British English, but the American people say any English words not like people in England a Most b same c any d > c 239 In Canada much people speak ... clearly > d 209 A father can change the baby, dressed the children or make the dinner a change b dressed c the d make > b 210 A father is the person who provides us for money to feed and clothe...

Ngày tải lên: 18/06/2014, 17:20

... of the FFTW library Defining p1 and p as 3D real images and P and P as complex means the dimension of the complex image can be halved and also the computation time in both the FT and IFT decreased ... fundamental pressure at a distance z In the kernel, the sums and multiplications have to be computed for the z + dz position and then are saved for the calculation of the next Varray et al EURASIP ... faster than the CPU on machine Regarding the computation time, it can be noted that an increase of a factor 30 in the number of GPU cores leads to a relatively weak performance gain However, the...

Ngày tải lên: 20/06/2014, 22:20

... http://www.sofa-framework org/) for small elastic deformations SOFA is an open-source C++ library for physical simulation and can be used as an external library in another program, or using one of the associated ... ΨT MΨ and ΨT KΨ are diagonal matrices, and are, respectively, called the modal mass and the modal stiffness of the system, because the ratio between modal stiffness and modal mass gives the matrix ... (2) Assemble the mass and the stiffness matrices (3) Modal analysis: solve the eigenproblem (4) Store eigenvalues and eigenvectors for sound synthesis Algorithm 1: Algorithm for modal parameters...

Ngày tải lên: 21/06/2014, 08:20

... instruments has resulted in several applications, such as the classical guitar [39], the Renaissance lute, the Turkish ud [45], and the clavichord [29] The two-manual harpsichord tackled in the current ... fixed manually Figure shows the loop gain and T60 data for an example case It is seen that the target data (bold dots in Figure 8) contain a fair amount of variation from one partial to the next ... possible accuracy is not the main goal of this work Rather, a simple and reliable routine to automatically process a large amount of measurement data is reached for, thus leaving a minimum amount...

Ngày tải lên: 23/06/2014, 01:20

... Karalic-Loncarevic, manager, Technical Information Center; Radiah Rose, manager, editorial projects; Orin Luke, senior program assistant; and Tamara Dawson, program associate We especially thank the ... MIRSADA KARALIC-LONCAREVIC, Manager, Technical Information Center RADIAH ROSE, Manager, Editorial Projects ORIN LUKE, Senior Program Assistant (through June 2011) TAMARA DAWSON, Program Associate ... science addresses chemical, physical, and biologic stressors and associated behavioral and societal factors that affect human and ecologic health, including protection of vulnerable populations and...

Ngày tải lên: 28/06/2014, 20:20

... select appropriate goals and courses of action for an organization.4 The organizational plan that results from the planning process details the goals of the organization and specifies how managers ... environments that have the potential to affect an organization We noted that changes in these forces can produce opportunities that an organization might take advantage of and threats that may harm its ... participate in the planning process to best analyze an organization’s present situation and the future scenarios that may affect it The Manager as a Planner and Strategist Determining the Organization’s...

Ngày tải lên: 05/07/2014, 19:20

... That's Oliver He's _ travel agent a a b an Leonardo di Caprio is _ actor a a b an Fred is electrician a a b an Mr Smith is _ teacher a a b an This is Gloria She's _ homemaker a a b an ... This is Gloria She's _ homemaker a a b an That's John He's _ police officer a a b an I'm student a a b an 10 a a b an Meryl Streep is actress ...

Ngày tải lên: 12/07/2014, 05:21