speech im giving an oral presentation not a written one
english for presentations at international conferences
... principal component analysis, and complete-linkage cluster analysis of mass spectral data, that is to say the relative abundance of peaks, was used as a tool for rapid comparison, differentiation, and ... make you understand what is, and is not, absolutely essential So, imagine you are about to give your presentation at an important international conference You have the last slot of the last day ... example, imagine you are talking about crops and cereals If you mention rice and maize and you have an audience of agrarians they will understand But if you mention specialist or less familiar...
Ngày tải lên: 26/10/2014, 07:30
The text doesn’t stop at the end of the page (or does it) an exploration of how the novel form responds to digital interactivity through the cross sited novel ‘once in a lifetime
... GeorgienHeathcliff, or Georgienheath, or Heathngeorgie or Fuckfacencockhead, or – and then the phone rang and rang and rang and rang and rang I took this incessant ringing as a sign, not that I should ... disdained love and laughter I could have done with a healthy dose of both at the time And although I did feel like a rock (albeit a crumbly one) and an island (Madagascar perhaps, or Phuket Actually ... head!” That’s hard That’s all hard But not the actual break-up, that’s easy It’s the day after the break-up that’s hard, and the next day and the next and however many days after that (perhaps...
Ngày tải lên: 04/12/2015, 14:00
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
... search engines "limits" area In this area can one designate an age group (ex: 45 to 60 years), date span of the literature search, (ex: 1998 to 2003), and to select either English language or articles ... searches one may find answers that were not known to exist, and information that may challenge an already preconceived notion The evidence summary should list the main author and year the paper was ... and health promotion Am J Prev Med 1992, 8:154-158 Bowerman S, Bellman M, Saltsman P, Garvey D, Pimstone K, Skootsky S, Wang HJ, Elashoff R, Heber D: Implementation of a primary care physician...
Ngày tải lên: 13/08/2014, 13:22
An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability
... ideas in a variety of ways 10 Having a range of vocabulary As can be seen from the diagram above, ideas and a range of vocabulary are always demonstrated by writers If writers have poor ideas and ... students at elementary level had writing lesson, they would need the teachers assistance at early stages Using a text as a model has both sides, advantages and disadvantages To begin with its advantages, ... the activities Teachers feed back about classs discussion on choosing ideas, students reading a model and vocabulary and organization Actual writing task analyzing the model Actual writing task...
Ngày tải lên: 18/12/2013, 10:08
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
A consideration of how to attract beginners to speaking lessons in Popodoo Foreign Language Centre
... Language Center current time has Vietnamese teachers, foreign teachers and 10 assistant teachers Advantageously, all of the teachers at Popodoo graduated from university and have a great deal ... strong oral language base would have an academic advantage because school achievement depends on students‘ ability to display knowledge in a clear and acceptable form in speaking as well as writing ... to attract and stimulate student so that students can improve themselves as fast as they can Understand and appreciate the school‘s philosophy and transmit it to students Create the optimum atmosphere...
Ngày tải lên: 25/03/2014, 12:19
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt
... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location of the Hudson Strait ice stream mouth and source, respectively the annual mean ... 2004) and changes in land-sea mask consistent with the latter, and an increase of psu to account for the ∼120 m sea-level lowering Vegetation and other land-surface characteristics as well as river-runoff ... largely exceeding the oceanic subsurface warming duration, translating in a second peak in sea level rise rate and an extended plateau of ice discharge after the main peak (see purple and gray...
Ngày tải lên: 30/03/2014, 16:20
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
... Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and not ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection; ... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx
... Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and not ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection; ... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt
... analysis of semi-volatile pollutants by means of gas chromatography-mass spectrometry operating in scan an SIM mode, in conjunction with appropriate data analysis applications and chemometric tools ... educational goals, the upgraded and strengthened LECOTOX will have an important task in the future, as well as the capability and capacity to offer its expertise and advice to policy and decision makers ... on their polarity, planarity and the of aromatic system, and the most active ones have been prioritised for further analysis aimed to identification and quantification of key pollutants |From...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo y học: "An exploration of how clinician attitudes and beliefs influence the implementation of lifestyle risk factor management in primary healthcare: a grounded theory study" pot
... 81:218-227 Amoroso C, Hobbs C, Harris M: General practice capacity for behavioural risk factor management: A SNAP-shot of a needs assesssment in Australia Australian Journal of Primary Health 2005, ... adequacy and role legitimacy on motivation and satisfaction Drugs: Education, Prevention and Policy 2005, 12:449-463 Ajzen I: The theory of planned behaviour Organizational Behaviour and Human ... qualitative data analysis, contributed to study design and data collection, and wrote the first draft of the manuscript LK and MH contributed to study design and data analysis GPD and AW contributed...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Improving eye care for veterans with diabetes: An example of using the QUERI steps to move from evidence to implementation: QUERI Series" ppsx
... conditions; and 5) advancing clinically-meaningful quality/performance measurement as an important tool for promoting and assessing quality improvement interventions Examples of work by DM-QUERI that address ... [33] and a general model of organizational change as described by Gustafson et al [34] Specifically, it has been shown that improvements in rates of adult immunization and cancer screening are ... bedside: a national crisis and a call to action JAMA 2003, 289(10):1305-6 Rubenstein LV, Pugh J: Strategies for promoting organizational and practice change by advancing implementation research J...
Ngày tải lên: 11/08/2014, 16:21
an investigation into how to use linking words in the development of speaking and writing skills for the ielts examination = nghiên cứu về việc sử dụng từ nối trong việc phát triển kỹ năng nói và viết
... Once we can write a good paragraph, the exam essay becomes easy, for it is really little more than five paragraphs and if we can write one paragraph, we can write five Another way to improve your ... has a defined input and a largely predictable output It is basically an information-transfer task which relates narrowly to the factual content of an input diagram and not to speculated explanations ... clear Lexical Resource This criterion refers to the range of vocabulary the candidate has used and the accuracy and appropriacy of that use in terms of the specific task Grammatical Range and Accuracy...
Ngày tải lên: 02/03/2015, 14:26
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... audience analysis, organization, stage fright, visual aids, eye contact and facial expressions, body language, voice, Q &A period, and language use in presentation Students can all know these factors ... than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages Questionnaire is familiar...
Ngày tải lên: 19/03/2015, 10:37
A study of how to motivate second-year English majors at the Faculty of English, Hanoi National University of Education Nghiên cứu cách tạo động lực cho sinh
... 2.4 The data collection procedures 41 Chapter 3: Data analysis, Findings, and Discussions 42 3.1 Data analysis 42 3.1.1 Results from classroom observation and analysis ... VIETNAM NATIONAL UNIVERSITY-HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST-GRADUATE STUDIES - - TRẦN NGỌC GIANG A STUDY OF HOW TO MOTIVATE SECOND-YEAR ENGLISH MAJORS ... Theoretical Background 1.1 Overview of motivation in language learning 1.1.1 Definition of motivation 1.1.2 Classification of motivation in language learning 1.1.3 The importance...
Ngày tải lên: 28/03/2015, 08:56
A study of how to motivate second-year English majors at the Faculty of English, Hanoi National University of Education = Nghiên cứu cách tạo động lực cho sinh
... Moreover, learner‟s failure to understand the language they hear is an impetus, not an obstacle, to interaction and learning Authentic spoken language presents a challenge for the learner to attempt ... understandable input As a result, they are deprived of a necessary condition for full language acquisition – access to understandable and engaging language 37 Neurological development Still another ... learners can rather than cannot Everybody is more interested in proceedings if they feel that they have an important part to play, and therefore, even hard-to-reach learners can be motivated by giving...
Ngày tải lên: 28/03/2015, 08:57
A study of how to motivate second-year English majors at the Faculty of English, Hanoi National University of Education
... motivation in learning and practicing this challenging skill What was changed during the course is the way to start it, the way in which each lesson is conducted and managed, and the way to assess ... & Malderez, A (1999) Group dynamics in foreign language learning and teaching In Arnold, J (ed.) Affective language learning Cambridge: CUP pp 155 – 69 12 Ellis, R (1997) Second language acquisition ... in classroom are also reintroduced Besides, the study also reconfirms the importance of motivation in education and in language learning 4.2 Practical significance The study is expected to facilitate...
Ngày tải lên: 10/08/2015, 19:47
An investigation into how to use linking words in the development of speaking and writing skills for the IELTS examination
... IELTS, Adams and Austen Press Pty.Ltd, Australia 10 Garry Adams and Terry Peck (2002), 202 Helpful Hints for IELTS, Adams and Austen Press Pty.Ltd, Australia 11 Halliday, M.AK and Hasan, Ruqaiya (1976), ... writing samples); analytical (examining in detail the statistics and also analyzing the data obtained) and synthetical (drawing striking features from the analysis) Also, we apply inductive reasoning ... discursive type and one sample of account type 5.2.3 Data analysis To the analysis, we use a coding system which aims to make our analysis clearer and easier to follow Semantic categories of linking...
Ngày tải lên: 10/08/2015, 19:50