source s of a monotonic change in the process mean vector

... whether the crosslinking adducts of (G-10L)94PhoE that were obtained are similar to the cross-linking adducts with a known substrate of the SRP pathway, FtsQ was used as a model This class II ... CE1513, strain MM88 was used as Table Bacterial strains and plasmids used in this study Ts, temperature sensitive Camr and Ampr, resistance to chloramphenicol and ampicillin, respectively Designation ... listed in Table Strains CE1514 and CE1515 were obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain...

Ngày tải lên: 08/03/2014, 09:20

Ngày tải lên: 12/03/2014, 00:21

... substrate docking analysis to assess the basis for the substrate specificity Results and Discussion Cloning and sequence analysis of SlUGT5 The SGN Unigene Database (http://solgenomics.net/) was ... sa ana 84B1 A th um tabac N ana thali a ian hal t va A ati s 4F1 1O GT T U SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia ... by Bradford assay (Bio-Rad, Hercules, CA, USA), using bovine serum albumin (BSA) as the standard Cell lysates and purified protein preparations were separated by SDS ⁄ PAGE, and protein bands were...

Ngày tải lên: 28/03/2014, 23:20

... This suggests that the nature of the metal ion has a predominant in uence on catalysis rather than substrate binding Substrate specificity of BphH Substrate specificity of Mg2+ saturated BphH was ... withdrawing substituent This is in line with previous proposal of a step-wise hydration mechanism in the HPDA hydratases [7] Microorganisms that possess the meta-cleavage pathways are useful ... molecular mass Protein concentrations were determined by the Bradford assay [27] using bovine serum albumin as standards SDS ⁄ PAGE was performed and stained with Coomassie blue according to established...

Ngày tải lên: 30/03/2014, 15:20

... regional peace and prosperity in the Asia-Pacific region In the security area, ASEAN established ASEAN Regional Forum (ARF) in 1994 to discuss security issues in this region ASEAN has also made ... Over the past 20 years, in parallel with the changes in global governance, East Asia has also experienced great changes in regional governance 1.4.2 Northeast Asia: Changes in Regional Cooperation ... conservative revisionist ideology At the same time, Northeast Asia has been constantly upgrading its position and influence in the international arena 1.4.3 Southeast Asia: Changes in Regional...

Ngày tải lên: 14/07/2014, 13:28

... herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the ... selected spring phenological stages and air temperatures in the period before the onset of the phenological stage results and discussion The aim of the paper was to evaluate phenological stages of a ...   Statistical characteristics – the dependence of the onset of phenological stages on the sum of effective temperatures Statistical processing showed the highest variability in Norway spruce and...

Ngày tải lên: 07/08/2014, 03:22

... change mean curve (AGCm curve) was based on annual values and was the mean of all AGC single values of all bog pines of the transect, using the median percentage values (for the reduction class ... increases abruptly in the driest part (spruce stand) Table I General characteristics of the tree stands in the three subplots of the transect For tree descriptors, mean and 1SD (in brackets) are ... descriptors for calculating the Euclidean distance matrix comparing all the individual trees Prior to the analysis, the data were standardised (zero mean and unit variance) Based on the similarity transformed...

Ngày tải lên: 08/08/2014, 01:21

... genotype in exon two and carcass fat levels in cattle Regression analysis (not shown) revealed that the thymine allele was associated with fatter carcasses and the C allele with leaner carcasses This ... (Biomed Instruments) was used to analyse autoradiographic bands to obtain the LEP/GAPDH ratios 2.5 Statistical analysis Allele frequencies between breeds were compared using chi-square analysis The ... role as a candidate gene for carcass fat levels in beef cattle M.Sc Thesis, University of Saskatchewan, Saskatoon, SK, 1999 [9] Gallant E.M., Curtis S. , Pace S. M., Dulhunty A. F., Arg615Cys substitution...

Ngày tải lên: 09/08/2014, 18:21

... metaphases were conventionally stained in Giemsa and 15 analysed for each animal III Results and discussion The distribution of the karyotype classes observed in the offspring of the bulls shown in ... from the leukocyte cultures of the offspring are of interest for following reason In contrast to the situation in the testes of bulls born as cotwins to freemartins in which any XX cells are at a ... that late vascular anastomosis prevented their migration in the first place The discovery of the bull twins chimeric for an autosomal marker chromosome, ins 16, provides a means of exploring these...

Ngày tải lên: 09/08/2014, 22:22

... emphasis to differences in drug availability across the region Methods Data from TAHOD, the Therapeutics Research, Education, and AIDS training in Asia (TREAT Asia) HIV observational database, ... Predictors of rates of combination treatment change Table shows factors associated with rates of combination treatment change In univariate analyses factors related to rate ratios of combination treatment ... range of treatment options Acknowledgements TREAT Asia is a program of The Foundation for AIDS Research, amfAR The TREAT Asia HIV Observational Database (TAHOD) is supported in part by grants...

Ngày tải lên: 10/08/2014, 05:20

... symptomatic arm in clear contrast to the Approximately one year had passed since the initial injury and based on the progressive weakness, new sensory findings, and ultrasonographic changes, median ... electrodiagnostic findings in the diagnosis of nerve entrapment neuropathies in the absence of anatomic abnormalities [3,5] This case demonstrates that it may be valuable in establishing an anatomic ... wrist and of the ulnar nerve at the elbow These studies have shown that HRUS is as a low-cost, noninvasive, painless adjunct to the nerve conduction studies in the diagnosis of these entities and...

Ngày tải lên: 10/08/2014, 10:20

... neutrophils and the presence of granulation tissue [2,3] In the present case, the biopsy was obtained at an early stage of the disease, a fact that may explain the absence of an ulcer Squamous metaplasia ... stabbing pain in the absence of clinical alterations of the mucosa These findings are important for the clinician, who must be aware that a swelling in the palate may not be an inflammatory process ... sequestration, ulceration, reparative stage, and healed stage During infarction, necrosis of the glandular acini predominates and culminates in the Oliveira Alves et al Journal of Medical Case...

Ngày tải lên: 10/08/2014, 23:20

... performed statistical analysis JBW drafted the manuscript RR and JL revised the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... tolerated in rhesus macaques Liver toxicity secondary to bacterial invasion can be a serious complication of Lm infection To assess Whitney et al Journal of Immune Based Therapies and Vaccines 2011, ... Hematological values and liver chemistries were unremarkable at all time points These results demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was safe and...

Ngày tải lên: 11/08/2014, 08:21

... provisional diagnosis of appendicitis was made Laparotomy was conducted through a grid-iron incision The appendix was normal in appearance Minimal bloodstained peritoneal fluid was noted on opening the ... competing interests AS was involved in the management of the case and wrote the manuscript draft VG conducted the literature research and revised the manuscript References The patient experienced an ... promising in establishing the diagnosis [4] However, a decreased blood flow should not rule out the suspicion of adnexal torsion MRI is a potential alternative, as it can demonstrate signs of hemorrhagic...

Ngày tải lên: 11/08/2014, 19:21

... transfer of injured patients for definitive vascular assessment and reconstruction [12,14] The use of vascular shunts in these circumstances was associated with very low limb amputation rates ... fixation Competing interests The authors declare that they have no competing interests Authors' contributions SAS was first assistant (subclavian exposure), carried out the literature review and ... reduction and internal fixation of the fractured humerus, after which a subclavian to brachial bypass was performed using reversed long saphenous vein The fracture was temporarily stabilised using...

Ngày tải lên: 11/08/2014, 21:22

... TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG ... ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC CACAAAACCAAAACTTCACATCCCATCC CTCACTATGGATTCTCCTAGCGGTGTCG ... acyltransferase cDNA was cloned and expressed in E coli, using a pET 3a expression vector SDSPAGE analysis demonstrated the presence of a heterologous protein of apparent molecular mass ~50 kDa (consistent...

Ngày tải lên: 12/08/2014, 03:20

... identified in which this virus may cause a serious impact on human health One of these areas may be the xenotransplantation of porcine tissues and organs to humans Xenotransplantation is a potential solution ... common in the USA but rare in Europe? Are there specific populations of rodents in the USA releasing this virus? Why is disease associated with XMRV in the USA but not in Europe? Is XMRV a passenger ... not a contributory factor in the pathogenesis of CSF [10] In light of these results, the finding of XMRV in prostate tumours and CFS patients in the USA has to be treated with great caution In the...

Ngày tải lên: 12/08/2014, 23:23

... only a variance in their longitudinal center of gravity Computer Systems Analysis of the Hypothesis The hypothesis was examined through a systems analysis approach using a derivative of a well-established ... http://www.tbiomed.com/content/7/1/8 ability to maintain venous return and cardiac filling rather than a diminished responsiveness of vascular resistance [2,25,26] These studies support the proposed hypothesis and are consistent ... 39216, USA Cardiovascular Laboratory, Space Life Sciences Directorate, National Aeronautics and Space Administration Johnson Space Center, Houston, Texas 77058, USA 3Human Research Office, NASA Glenn...

Ngày tải lên: 13/08/2014, 16:20

... decision in case of J Craig Venter vs Nature, Science and Cell, scientists have had the right to submit their papers simultaneously to as many journals as they like, and to have the same paper published ... sensitivity training workshop, required of all faculty by the Office of Self-Esteem, which has controlled all US universities since the Political Correctness Wars of 2014 Was reminded yet again that any ... consisted of trans-fat sandwich on tobacco leaf bread Paused to reflect how amazing that earlier generations of scientists actually considered this unhealthy - exactly the opposite of what careful research...

Ngày tải lên: 14/08/2014, 18:20

... reduction The use of the decay detector information in the graphical analysis of these events has significantly enhanced the S/ N ratio and has led to the identification of events with cascade decays such ... could be applied The full analogue information has been retained for subsequent steps of the analysis such as the rejection of hadronic interactions in the silicon planes (as described in Section ... such as the one shown in Fig The background evaluation in the final sample is still in progress, but the presence of events with very strong signatures characteristic of beauty decays gives us confidence...

Ngày tải lên: 16/12/2017, 14:59