some suggested tasks activities used in the three main stages of a reading lesson

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Ngày tải lên : 14/02/2014, 14:20
... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Ngày tải lên : 21/02/2014, 03:20
... considered as follows The role and importance of the aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl ... side-chain of His210 increased with the decrease in size of the side-chain at residue 169 (Table and Fig 3A) However, the ASAs of Asp113 and His57 remained constant when the side-chain at residue ... side-chain of His210 On the other hand, a small side-chain at position 169, typically W169V and W16 9A, deviates from the original position In the structural deviation, the solvent ASA of the side-chain...
  • 7
  • 603
  • 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Ngày tải lên : 06/03/2014, 09:22
... to concanavalin A (data not shown), ¨ indicating that N-linked glycosylation may account for the increased mass In the absence of b-mercaptoethanol, proSpatzle- 1A migrated to a position around ... cleavage of proSpatzle- 1A after ¨ incubation with the M sexta clip-domain serine proteinases HP6 or proPO-activating proteinase-1 (data A not shown) In the absence of b-mercaptoethanol, Spatzle-C108 ... for fat body cDNA) was used as template for quantitative RT-PCR analysis The M sexta ribosomal protein S3 (rpS3) mRNA was used as an internal standard to normalize the amount of RNA template The...
  • 15
  • 540
  • 0
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot

Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot

Ngày tải lên : 20/06/2014, 20:20
... compensate for matrix effects and methodological losses of analytes For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The ... toxicological characteristics Page of 13 of wastewater in dependence on the spatial and temporal patterns of the respective rainfall events Furthermore, the attending increase of wastewater volume causes ... design of the study PF was mainly involved in the acquisition, analysis, and interpretation of data, as well as in the writing of the paper RB focused on scientific support and contributed to the interpretation...
  • 13
  • 589
  • 0
báo cáo hóa học:" Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage " pdf

báo cáo hóa học:" Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage " pdf

Ngày tải lên : 21/06/2014, 17:20
... compensate for matrix effects and methodological losses of analytes For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The ... toxicological characteristics Page of 13 of wastewater in dependence on the spatial and temporal patterns of the respective rainfall events Furthermore, the attending increase of wastewater volume causes ... design of the study PF was mainly involved in the acquisition, analysis, and interpretation of data, as well as in the writing of the paper RB focused on scientific support and contributed to the interpretation...
  • 13
  • 475
  • 0
Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot

Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot

Ngày tải lên : 11/08/2014, 21:22
... appraised the manuscript All authors have read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying ... MR appearances, the differential diagnosis was either a tumour or an abscess Given that the patient was septic, this cystic lesion with an enhancing capsule was likely to be an abscess rather ... the collection and clear urine via Figure fat saturation and gadolinium enhancement T1-weighted coronal magnetic resonance imaging scan with T1-weighted coronal magnetic resonance imaging scan...
  • 3
  • 306
  • 0
Báo cáo y học: " Leadership is the essential non-technical skill in the trauma team - results of a qualitative study" pps

Báo cáo y học: " Leadership is the essential non-technical skill in the trauma team - results of a qualitative study" pps

Ngày tải lên : 13/08/2014, 23:20
... Flexibility/responding to change Setting and maintaining standards Supporting others Coping with pressure Leadership Communication and Teamwork Exchanging information Establishing a shared understanding Co-ordinating ... mentioned the importance of maintaining the authority of the leader in a situation where the leader needs help from the others It was emphasized that the team needs to strengthen the leader, thus ... (13) taxonomy Category Element Our findings Situation awareness Gathering information Understanding information Projecting and anticipating future state Most of the informants emphasised that a good...
  • 9
  • 289
  • 0
figures of substitution used in the language of advertising in some vietnamese and english advertisements = các phép tu từ thay thế được dùng trong ngôn ngữ quảng cáo qua một số quảng cáo bằng tiếng việt và tiếng anh

figures of substitution used in the language of advertising in some vietnamese and english advertisements = các phép tu từ thay thế được dùng trong ngôn ngữ quảng cáo qua một số quảng cáo bằng tiếng việt và tiếng anh

Ngày tải lên : 02/03/2015, 14:31
... for themselves If you are interested in learning how to create animated teaching aids, take a look at some of the animation programs available - some of them available as online programs One page ... if a teacher can decide what kind of material for teaching and learning that goes on in a class, impacts a students, the teacher may be able to make modifications within the framework of the ... learning the language concerned; and (c) Attitude towards languages and language learning in general.' They may also be influenced by the particular social milieu within which the language learning...
  • 52
  • 553
  • 0
Pre listening activities used in listening lessons = sử dụng hoạt động trước nghe trong các bài giảng

Pre listening activities used in listening lessons = sử dụng hoạt động trước nghe trong các bài giảng

Ngày tải lên : 19/12/2013, 14:05
... between a married couple, Linda and John, who are talking about a house that they have just seen and that they are thinking of buying (Headway Pre-Intermediate) Before starting such a listening task, ... 1.1.2 The importance of listening skill As a rule, we always mention main skills of studying English as well as any second language in the following order: Listening, speaking, reading and writing ... more aware of great learning value of pre-listening activities and their procedures to apply them into listening lessons in order to achieve a totally successful teaching and learning result - Introducing...
  • 53
  • 407
  • 6
Some suggested communicative activities to teach grammar for 10th form english classes

Some suggested communicative activities to teach grammar for 10th form english classes

Ngày tải lên : 20/12/2013, 18:33
... importance of grammar and applying activities to teach grammar communicatively - To get some information about the real situation of teaching and learning grammar with creating and applying activities ... examinations in Vietnam are the school final examination and the university entrance examination Neither has a listening and speaking component Due to the pressure to pass the examinations, the ... communicative needs, then they getting what they need 1.1.3 The role of Grammar in Learning Language The importance of grammar in learning language is undeniable There is no doubt that a language- implicit...
  • 64
  • 696
  • 3
Báo cáo khoa học: Origins of DNA replication in the three domains of life pdf

Báo cáo khoa học: Origins of DNA replication in the three domains of life pdf

Ngày tải lên : 07/03/2014, 21:20
... nucleotide-binding domain that can bind ATP and catalyse its hydrolysis The conformation of the AAA+ domain alters depending on the phosphorylation status of the bound nucleotide Furthermore, AAA+ proteins ... proteins [60,61] As can be seen in Fig 4, both proteins possess N-terminal AAA+ domains and C-terminal DNA binding domains (DBDs) In DnaA, the DBD contains a helix-turn-helix; in the archaeal proteins, ... providing the first experimental proof of a localized origin of replication in the archaea [52] Interestingly, in a situation reminiscent of that in several bacteria where their origin is adjacent...
  • 10
  • 504
  • 0
MERCHANDISING – MODERN TECHNIQUE USED IN THE PROCESS OF GOODS SALES docx

MERCHANDISING – MODERN TECHNIQUE USED IN THE PROCESS OF GOODS SALES docx

Ngày tải lên : 16/03/2014, 15:20
... organism, situated in a dynamic socialeconomic frame; this involves from the management the manifestation of the capacity of adaptation to the environment changes and in the same time of market prevision, ... modifications in the sales forms, in the sales apparatus structure, but also to the considerable increase of the number of offered products, modifications appeared in the purchasing behavior of the ... sales and gain new markets As a result of its practical importance, in the key point of the sales (the shop), the issues and techniques of merchandising are the preoccupation of both traders and...
  • 6
  • 515
  • 3
REASONS WHY HORMONES ARE NOT USED IN THE POULTRY INDUSTRY ppt

REASONS WHY HORMONES ARE NOT USED IN THE POULTRY INDUSTRY ppt

Ngày tải lên : 17/03/2014, 10:20
... mortality I explain to them that we are not a regulatory agency but I think the main thing they want is someone who will listen to them and not ignore their Maybe some of the following ideas are worth ... after dark If spreading litter on crop land, disc the litter in within 48 hours of spreading Planting a pine/cedar tree curtain around the perimeter of the property so neighbors and the general public ... neighbors and try to be accommodating when a neighbor lets them know about upcoming family gatherings Most of the laws and regulations that the allied livestock industry face today was put in place...
  • 5
  • 1.3K
  • 0
Báo cáo toán học: " Weak convergence theorem for the three-step iterations of non-Lipschitzian nonself mappings in Banach spaces" pptx

Báo cáo toán học: " Weak convergence theorem for the three-step iterations of non-Lipschitzian nonself mappings in Banach spaces" pptx

Ngày tải lên : 20/06/2014, 21:20
... concept of asymptotically nonexpansive in the intermediate sense nonself mappings was introduced by Chidume et al [20] as an important generalization of asymptotically nonexpansive in the intermediate ... completes the proof Remark 3.2 Theorem 3.1 extends the main results in [4,16,18,20]to the case of asymptotically nonexpansive in the intermediate sense mappings and it seems to be new even in the case ... Udomene, A: Fixed point solutions of variational inequalities for asymptotically nonexpansive mappings in Banach spaces Nonlinear Anal: Theory Methods Appl 64(3), 558–567 (2006) doi:10.1016/j.na.2005.03.114...
  • 13
  • 360
  • 0
báo cáo hóa học:" Weak convergence theorem for the three-step iterations of non-Lipschitzian nonself mappings in Banach spaces" doc

báo cáo hóa học:" Weak convergence theorem for the three-step iterations of non-Lipschitzian nonself mappings in Banach spaces" doc

Ngày tải lên : 21/06/2014, 17:20
... concept of asymptotically nonexpansive in the intermediate sense nonself mappings was introduced by Chidume et al [20] as an important generalization of asymptotically nonexpansive in the intermediate ... completes the proof Remark 3.2 Theorem 3.1 extends the main results in [4,16,18,20]to the case of asymptotically nonexpansive in the intermediate sense mappings and it seems to be new even in the case ... Udomene, A: Fixed point solutions of variational inequalities for asymptotically nonexpansive mappings in Banach spaces Nonlinear Anal: Theory Methods Appl 64(3), 558–567 (2006) doi:10.1016/j.na.2005.03.114...
  • 13
  • 289
  • 0
DESCRIPTION OF THE 406 MHz PAYLOADS USED IN THE COSPAS-SARSAT GEOSAR SYSTEM pdf

DESCRIPTION OF THE 406 MHz PAYLOADS USED IN THE COSPAS-SARSAT GEOSAR SYSTEM pdf

Ngày tải lên : 27/06/2014, 04:20
... 3A INSAT 3D MSG-1 MSG-2 2.1 USA USA USA Russia India India EUMETSAT EUMETSAT Status Operational Operational Operational Planned Operational Planned Operational Operational 406 MHz GEOSAR Payload ... gain over the coverage area, and with the satellite spin, the gain fluctuates above this value at a rate of 26.7 Hz The measured fluctuation (gain ripple) is 1.3 dB peak to peak in the south and ... with an edge of coverage (EOC) gain of 11.0 dB The receive antenna has a maximum axial ratio of dB The INSAT extended C-Band transmit antenna is a directive antenna that provides coverage for the...
  • 48
  • 368
  • 0
The Earth Inside and Out: Some Major Contributions to Geology in the Twentieth Century+ pdf

The Earth Inside and Out: Some Major Contributions to Geology in the Twentieth Century+ pdf

Ngày tải lên : 27/06/2014, 15:20
... geometrical and temporal, in Nature These two ways of looking at, or thinking about, the world can be seen in the ancient atomists and in the Artistotelians I am not aware that many have adopted ... The arguments of some stratigraphers and palaeontologists that the great change of flora and fauna at the end of the Cretaceous, including the demise of ammonites and dinosaurs, does not coincide ... Oxford INTERNATIONAL ASSOCIATION OF GEOMAGNETISM AND AERONOMY (IAGA) AND INTERNATIONAL ASSOCIATION OF SEISMOLOGY AND PHYSICS OF THE EARTH'S INTERIOR (IASPEI) OF THE INTERNATIONAL UNION OF GEODESY AND...
  • 376
  • 364
  • 0
Lignocell ulosic Precursors used in the Synthesis of Activated Ca rbon - Characterization Techniques and Appl ications in the Wastewa ter Treatment potx

Lignocell ulosic Precursors used in the Synthesis of Activated Ca rbon - Characterization Techniques and Appl ications in the Wastewa ter Treatment potx

Ngày tải lên : 28/06/2014, 17:20
... Germany Greece Poland Ukraine UK Egypt Algeria Moroco USA Mexico Colombia Canada Brazil Chile Cuba Taiwan India China Malaysia Singapore Japan Thailand Bangladesh Cyprus Oman Russia Vietnam Turkey Figure ... Used in the Synthesis of Activated CarbonCharacterization Techniques and Applications in the Wastewater Treatment Thermal Treatments and Activation Procedures Used in the Preparation of Activated ... Precursors Used in the Synthesis of Activated CarbonCharacterization Techniques and Applications in the Wastewater Treatment 26 In general, the preparation of ACs by chemical activation with KOH and NaOH...
  • 100
  • 406
  • 0

Xem thêm