some possible applications of a si h fets

Báo cáo hóa học: " Impact of AFM-induced nano-pits in a-Si:H films on silicon crystal growth" potx

Báo cáo hóa học: " Impact of AFM-induced nano-pits in a-Si:H films on silicon crystal growth" potx

... 1b shows that the depth of the pit is 100 nm The full-width-at-half-maximum (FWHM) is 200 nm In Figure 1e is shown the local conductivity map of the same area obtained at the sample bias voltage ... selective growth of Si micro- and nano-crystals Note that the nanocrystals, which are scattered randomly across the surface or just around the pit, are also conductive compared to the a- Si: H background, ... This is most likely because they are grown on the a- Si: H film (with possibly additional amorphous incubation layer [17]) It can be assumed that the much higher conductivity of the nanocrystals...

Ngày tải lên: 21/06/2014, 05:20

6 290 0
Tài liệu Báo cáo khoa học: "Some Novel Applications of Explanation-Based Learning to Parsing Lexicalized Tree-Adjoining Grammars"" doc

Tài liệu Báo cáo khoa học: "Some Novel Applications of Explanation-Based Learning to Parsing Lexicalized Tree-Adjoining Grammars"" doc

... machine reaches the final state, then the test pattern matches one of the stored patterns Given that the index of a test sentence matches one of the indices from the training phase, the generalized ... retrieving a generalized parse allows for parsing of sentences of the same lengths and the same POS sequence as those in the training corpus However, in our approach there is another generalization that ... the frontier of an auxiliary tree, whose label matches the label of the root of the tree, is marked as a foot node by a ' ' ; the other nodes on the frontier of an auxiliary tree are marked as...

Ngày tải lên: 20/02/2014, 22:20

8 388 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 301 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA ... CCCACTAGACCGAACCGTTGCTTTAGATTTTTGGCGCAACACGCGCTC P T R P N R C F R F L A Q H A L CGATGCGACCCCGAGTACGTTCCCCACGACGTGATCCGCATCGTCGAA R C D P E Y V P H D V I R I V E CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG...

Ngày tải lên: 20/06/2014, 01:20

11 854 0
Báo cáo sinh học: " Research Article Applications of a Weighted Symmetrization Inequality to Elastic Membranes and Plates" pptx

Báo cáo sinh học: " Research Article Applications of a Weighted Symmetrization Inequality to Elastic Membranes and Plates" pptx

... be added to the standard list of existing rearrangement inequalities since it can serve, mathematically, physical situations in which the object, whether it is a membrane, plate, or so forth, ... boundary, is dominated by the deflection of another plate, similarly hinged at the boundary, with uniform density See 9, 10 for similar results The last result of this paper is somewhat similar ... ≥ a0 > 0, for some constant a0 ii h is almost radial in the sense that there exists a radial function h0 ≥ such that ch0 x ≤ h x ≤ h0 x , in Ω, 2.8 for some c ∈ 0, iii There exists K > such...

Ngày tải lên: 21/06/2014, 17:20

12 177 0
Báo cáo toán học: "On the possible orders of a basis for a finite cyclic group" potx

Báo cáo toán học: "On the possible orders of a basis for a finite cyclic group" potx

... with small doubling The technical aspects of the proof are given in Section 3, roughly as follows On the one hand, the statement of the theorem says something about the possible orders of a basis ... from the literature that we shall use is a special case of a result of Lev [L], generalising an earlier result of Freiman [F], concerning the growth of sumsets of a large subset of an arithmetic ... xL = y where (xi , xi+1 ) ∈ E for all i < L Such a walk has length L A walk with no repeated vertices is called a path; clearly, the shortest walk from x to y is always a path A digraph D is primitive...

Ngày tải lên: 08/08/2014, 12:22

10 355 0
Báo cáo toán học: "Further applications of a power series method for pattern avoidance" ppt

Báo cáo toán học: "Further applications of a power series method for pattern avoidance" ppt

... words avoiding xx over a 7-letter alphabet; as far as we are aware, the smallest alphabet size for which the avoidability of xx has been shown using the local lemma is 13 [18] Proof of Theorem ... (a) If p has length at least 2k then p is 4-avoidable (b) If p has length at least 3k then p is 3-avoidable (c) If p has length at least 4k then p is 2-avoidable A power series approach Rather ... − ak words w of length k over an m-letter alphabet that contain a word in S as a factor On the other hand, for any such w either (a) w = w ′ a, where a is a single letter and w ′ is a word of...

Ngày tải lên: 08/08/2014, 14:23

8 234 0
Báo cáo lâm nghiệp: "Ecological light measurement in forests using the light degradation effect in hydrogenated amorphous silicon(a-Si:H)" pot

Báo cáo lâm nghiệp: "Ecological light measurement in forests using the light degradation effect in hydrogenated amorphous silicon(a-Si:H)" pot

... account of various details, which Brunner (1994) characterized as follows (see also Baldocchi and Collineau, imperative that as many sample possible be taken on account of the great spatial and ... In an evaporation system 16 aluminium contact pairs about 0.3 mm thick are applied with the aid of steel shadow masks The area for each contact is about x mm and the contact pairs are placed at ... thin a- Si: H film is related to the wave length, which leads to an increasingly irregular absorption behaviour with increasing sample thickness and decreasing wave length Modification of layer thickness...

Ngày tải lên: 08/08/2014, 18:21

13 194 0
confessions of a microfinance h - hugh sinclair

confessions of a microfinance h - hugh sinclair

... Maputo was no paradise As an anthropologist she was curious to go to Africa, and I had arranged a reasonable apartment in a safe area of town with a view over the ocean and near some relatively safe ... Mozambique He was aware of, and concerned about, some of the problems at FCC, and he was highly intelligent Park was a rare example of a professional, well-qualified practitioner with a passion ... be at all happy Maybe I should have done a little more research before accepting this assignment The place had presumably changed significantly since Bob Dylan’s vacation here, and I made a mental...

Ngày tải lên: 04/11/2014, 11:03

251 194 0
Applications of a novel cho glycosylation mutant

Applications of a novel cho glycosylation mutant

... (dhfr) gene, 5' end 32 ACTAGCCTTAAAGACAGACAGCTTTGTTCTAGTCAGCCAGGCAAGCATATGTAAATAAAGTTCCTCAGG GAACTGAGGTTAAAAGATGTATCCTGGACCTGCCAGACCTGGCCATTCACGTAAACAGAAGATTCCGCC TCAAGTTCCGGTTAACAACAGGAGGCAACGAGATCTCAAATCTATTACTTCTAATCGGGTAATTAAAAC ... ACCTCCTCAGTGGAAGGTAATTTGGGGTTAAGATGAGGATTTCTAGGGTTTGTATGAAGCAAGATTTCC AATGCAGACGTGGAAGTGCGAAGTCTCCCGTGGGAATCTGGGAACTTTGCTTCTTGGCAGAAATTTTTG TGCTGTTCCCAGAGTTTATTAAGCATCCTCTTTATATACAAAATATTTGAAATTTTGTTAGCAAGAGCA GTT The ... TGCCCGCGGTGATCCCCATGCTGTGCCAGCCTTTGCCCAGAGGCGCTCTAGCTGGGAGCAAAGTCCGGT CACTGGGCAGCACCACCCCCCGGACTTGCATGGGTAGCCGCTGAGATGGAGCCTGAGCACACGTGACAG GGTCCCTGTTAACGCAGTGTTTCTCTAACTTTCAGGAACGAATTCAAGTACTTCCAAAGAATGACCACC ACCTCCTCAGTGGAAGGTAATTTGGGGTTAAGATGAGGATTTCTAGGGTTTGTATGAAGCAAGATTTCC...

Ngày tải lên: 09/09/2015, 11:11

127 240 0
Development and applications of a vision based unmanned helicopter

Development and applications of a vision based unmanned helicopter

... platform and moving target, which may cause large motion of background in the image, as well as significant changes of shape, size and appearance of targets in the image That may caused many tracking ... considered to be a special case of target acquisition and targeting The main challenge of vision-based landing is altitude change, which significantly change the scale of landmarks in image Therefore, ... generated map, we can perform the path planning and avoid the obstacles There have been many studies on UAV path planning using various algorithm approaches, such as Dijkstra Algorithm, A algorithm,...

Ngày tải lên: 11/09/2015, 09:58

205 370 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

... differences, the charge densities of the clean Si substrate, 1 9H -Si( 111)- and isolated H atoms are calculated with the same lattice parameters and atomic positions as the relaxed Ag adsorbed 1 9H -Si( 111)-7 ... accumulation takes place around the third Si atom bonding with Ag at the second layer (not in the plane of Fig 3c), which has not been adsorbed by H The charge around the H atom at the Si adatom ... whereas the negative contours (dashed lines) represent the charge depletion The charge density depletes around the H atom and transfer toward the Si adatom when the H sits on the Si adatom There...

Ngày tải lên: 22/06/2014, 00:20

6 368 0
A study on some major factors affecting English learning of grade 6 ethnic minority students of a mountainous secondary school to help them learn better

A study on some major factors affecting English learning of grade 6 ethnic minority students of a mountainous secondary school to help them learn better

... 1-kilometer afar Those daily disadvantages sometimes made them have not much enthusiasm for their work Thirdly, when talking about their daily teaching in the class, both teachers agreed that the main hindrance ... children to learn English as much as they can both at home and at school Meanwhile, there are out of them not care what language their children are learning and speaking, out of them (12%) have ... hypothesis A real situation of teaching and learning English in a mountainous school has been made clear, which is shown that some factors such as teaching strategies, the social context, the textbook,...

Ngày tải lên: 07/11/2012, 15:04

39 1,5K 6
English morpheme system and some applications of learning morpheme in establishing words

English morpheme system and some applications of learning morpheme in establishing words

... the grammatical end of the continuum are called grammatical morphemes Note that grammatical morphemes include forms that we can consider to be words like the, a, and, and of and others that make ... which they attach A Prefix B Suffix C Affix An affix that attaches to the beginning of a stem A Prefix B Suffix C Affix Morphemes that change the meaning or lexical category of the words to which ... be attached to the word They are prefixes, infixes, suffixes, such as {happy} as in unhappy, happily, happiness) or they may be grammatical (such as called, closing, and faster) 1.2.2 Affixational...

Ngày tải lên: 08/04/2013, 09:31

22 2,3K 6
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

... blades which are attached vertically to the central shaft through support arms as shown in the Figure The support to vertical axis helps the rotor maintain its shape It is self-regulating in all ... wind energy E-mail address: sukantamech07@gmail.com Agnimitra Biswas is a PhD student from NIT, Silchar, working under the guidance of Prof Rajat Gupta He has done his M.Tech in Thermal Engineering ... computational maximum Ct at different H/ D ratios Figure 26 shows the comparison of the variations of computational and experimental maximum Cp values for each H/ D ratio, whereas Figure 27 shows the comparison...

Ngày tải lên: 05/09/2013, 15:28

16 364 0
A study of some linguistic features of expressions describing the villains in kiều story and their english translational equivalents

A study of some linguistic features of expressions describing the villains in kiều story and their english translational equivalents

... seducer The phrases an unfaithful lover and a lady- killer have similar literal meaning to the original; meanwhile, a cad which is a man who behaves dishonourably, especially towards a woman was communicative ... Ki u was still pondering over what had happened when there appeared a face on an areca-spathe, the well known- To open a brothel they had gone on shares, face of S Khanh For years, to trade dollies ... a depraved wretch that bad! V3: [25, p.114] She did not know that Scholar Ma, the rogue, he had always patronized the haunts of lust [38, p.619] V1: And so far, she had feigned to talk and laugh...

Ngày tải lên: 26/11/2013, 13:21

13 834 2
w