... nal conditions on initial conditions, as in the Taylor model based integrators (Berz and Makino, 1998), the linearizations are computed automatically and are readily available Step With a ... allows the denition of a DA-contracting operator, and the application of the DA Fixed Point Theorem Again, this coordinate shift can be performed automatically within the semialgebraic DA framework ... of order , the denition assures that for a -th order Taylor model , the antiderivative is again a -th order Taylor model Moreover, since all terms of of exact order are bound into the remainder,...
Ngày tải lên: 12/01/2014, 21:46
... [10] A Connes, Noncommutative Geometry, Academic Press, San Diego, CA (1994) [11] Z Djadli, A Malchiodi, and M Ahmedou, Prescribing a fourth order conformal invariant on the standard sphere – Part ... E-mail address: brendle@math.princeton.edu References [1] D Adams, A sharp inequality of J Moser for higher order derivatives, Ann of Math 128 (1988), 385–398 [2] T Branson, S.-Y A Chang, and ... functional, de Rham cohomology, and K¨hler-Einstein metrics, a Ann of Math 148 (1998), 315–337 [17] M Gursky, The principal eigenvalue of a conformally invariant differential operator, with an application...
Ngày tải lên: 28/03/2014, 22:20
báo cáo hóa học:" Research Article Solvability of a Higher-Order Nonlinear Neutral Delay Difference Equation" pdf
... Equations, Kluwer Academic Publishers, Dordrecht, The Netherlands, 2000 R P Agarwal, E Thandapani, and P J Y Wong, “Oscillations of higher- order neutral difference equations,” Applied Mathematics Letters, ... R P Agarwal and S R Grace, “Oscillation of higher- order nonlinear difference equations of neutral type,” Applied Mathematics Letters, vol 12, no 8, pp 77–83, 1999 S S Cheng and W T Patula, “An ... help, careful reading and editing, valuable comments and suggestions References R P Agarwal, Difference Equations and Inequalities: Theory, Methods, and Application, vol 228 of Monographs and Textbooks...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Research Article On a Conjecture for a Higher-Order Rational Difference Equation" ppt
... Berenhaut and S Stevi´ , “The global attractivity of a higher order rational difference equation,” c Journal of Mathematical Analysis and Applications, vol 326, no 2, pp 940–944, 2007 X Li, “Qualitative ... properties for a fourth -order rational difference equation,” Journal of Mathematical Analysis and Applications, vol 311, no 1, pp 103–111, 2005 X Li, “Global behavior for a fourth -order rational difference ... equation,” Journal of Mathematical Analysis and Applications, vol 312, no 2, pp 555–563, 2005 A M Amleh, N Kruse, and G Ladas, “On a class of difference equations with strong negative feedback,”...
Ngày tải lên: 22/06/2014, 11:20
Báo cáo hóa học: "GLOBAL BEHAVIOR OF A HIGHER-ORDER RATIONAL DIFFERENCE EQUATION" doc
... an+4 = an+3 an+2 an = an+2 an+1 an 1 an+2 an = an+1 an an 1 = an an 1 an 3 an an 1 (2.6) = an 3 If (i0 ,i1 ) = (1,2), then in a similar fashion, it is true that an+4 = an 3 for any n (2) If (i0 ... Journal of Difference Equations and Applications (1998), no 1, 497–499 [7] X Li, Global behavior for a fourth -order rational difference equation, Journal of Mathematical Analysis and Applications ... (0,2), then from Proposition 2.2, it follows that for any n 0, an+3 = an+2 an an 1 = an+1 an 1 an 2 an an 1 = an+1 an an 2 = an an 2 an 3 an an 2 (2.7) = an 3 (3) It follows from Proposition 2.3...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo hóa học: "A CLASSIFICATION SCHEME FOR NONOSCILLATORY SOLUTIONS OF A HIGHER ORDER NEUTRAL DIFFERENCE EQUATION" ppt
... Difference Equations, Taylor & Francis, London, 2003 [4] S S Cheng, G Zhang, and W.-T Li, On a higher order neutral difference equation, Mathematical Analysis and Applications (Th M Rassias, ed.), Hadronic ... Cheng, and G Zhang, A classification scheme for nonoscillatory solutions of a higher order neutral nonlinear difference equation, Journal of the Australian Mathematical Society Series A 67 (1999), ... Hadronic Press, Florida, 2000, pp 37–64 [5] X Z He, Oscillatory and asymptotic behaviour of second order nonlinear difference equations, Journal of Mathematical Analysis and Applications 175 (1993),...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo y học: "forms a higher order oligomer and enhances ATPase activity of replication initiator protein (Rep/AC1)" ppsx
... experiments: All_AC3_Fwd: 5'- CATGAGCTCGGATCCATGGATTCACGCACAGGG -3' All_AC3_Rev: 5'- CCATCTAGACTCGAGTGGCRTGTACTCAYGCCTCTAAYCC -3' ToLCV_AC1_Fwd: 5'- CATGGATCCATGGCHVCYCCMAAWCG -3' ToLCV_AC1_Rev: 5'- TGACTCGAGTCAACYCGWCGACGHCTGG ... enhances the ATPase activity of AC1 gives light on the way AC3 enhances viral DNA replication At higher concentration, AC3 failed to upregulate AC1-mediated ATPase activity indicating that AC1 ... forms a faint peak at 11 th fraction and a prominent peak at 32 nd fraction as indicated by 'V' Arrows indicate the peak formation of molecular weight standard proteins: Aldolase (158 kDa) at 17...
Ngày tải lên: 12/08/2014, 04:20
Verified intergration of ODEs and flows using differential albegraic method on higher order taylor model makino
Ngày tải lên: 12/01/2014, 22:19
Báo cáo sinh học: " Periodic solutions for a class of higher order difference equations" potx
... solutions for a class of higher- order difference equations Huantao Zhu1 and Weibing Wang∗2 Hunan College of Information, Changsha, Hunan 410200, P.R China Department of Mathematics, Hunan University ... Schauder’s fixed point theorem is crucial in our arguments Lemma 3.2 [16] Let X be a Banach space with D ⊂ X closed and convex Assume that T : D → D is a completely continuous map, then T has a ... University of Science and Technology, Xiangtan, Hunan 411201, P.R China *Corresponding author: gfwwbing@yahoo.com.cn Email address: HZ: zhu-huan-tao@163.com Abstract In this article, we discuss...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Research Article Existence and Multiplicity of Positive Solutions of a Boundary-Value Problem for Sixth-Order ODE with Three Parameters" pdf
... equation arising in a phase field model,” Indiana University Mathematics Journal, vol 39, no 4, pp 1197–1222, 1990 G Caginalp and P C Fife, Higher- order phase field models and detailed anisotropy,” ... 2.1 Let A b2 − 3ac, B bc − 9ad, C c2 − 3bd, Δ B2 − 4AC, 2.2 one has the following: Equation 2.1 has a triple root if A B 0, Equation 2.1 has a real root and two mutually conjugate imaginary roots ... the linear differential Au Bu Cu operator Lu u At the same time, in investigating such spatial patterns, some other high -order parabolic differential equations appear, such as the extended Fisher-Kolmogorov...
Ngày tải lên: 21/06/2014, 11:20
Tài liệu 76 Higher-Order Spectral Analysis pptx
... data, HOS are quite natural tools in the analysis of nonlinear systems operating under a random input General relations for arbitrary stationary random data passing through an arbitrary linear ... DOA DOA GEN GL STAT HARM EST HARM GEN MA EST MATUL QPC GEN QPC TOR RP IID TDE TDE GEN AR parameter estimation based on cumulants ARMA parameter estimation via the Q-slice algorithm ARMA parameter ... described approach are sensitivity to model order mismatch, and AR estimation errors that propagate in the estimation of the MA parameters A significant amount of research has been devoted to the ARMA...
Ngày tải lên: 16/12/2013, 04:15
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... Chu GC, Katakura K, Tomita T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxygenase Hmu ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of ... nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture were analogous, but not identical, to those...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: "a Precision-Order-Recall MT Evaluation Metric for Tuning" pdf
... parallel training data is from Canadian Hansard data, containing 59.3M word tokens We used two LMs in loglinear combination: a 4-gram LM trained on the target side of the parallel training data, ... Workshop on Statistical Machine Translation and MetricsMATR, pages 324–328 H Isozaki, T Hirao, K Duh, K Sudoh, H Tsukada 2010 Automatic Evaluation of Translation Quality for Distant Language Pairs In ... several language pairs, according both to automatic metrics and human evaluations In future work, we plan to tune the free parameter α for each language pair References S Banerjee and A Lavie...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu DYNAMIC HIGHER ORDER EXPECTATIONS doc
... vector valued latent process and have been applied both to calibrated macro models, as in Nimark (2008) and Graham and Wright (2010) as well as to estimated finance and macro models as in Nimark (2010) ... order expectations can be modeled explicitly in a dynamic setting without making additional assumptions to ensure that private information is short lived The approach has at least two advantages ... solve a model in this class by assuming that the state is revealed perfectly with a lag This approach avoids explicitly modeling higher order expectations by using that agents not intrinsically care...
Ngày tải lên: 20/02/2014, 19:20
Tài liệu Báo cáo khoa học: "Some Uses of Higher-Order Logic in Computational Linguistics" pdf
... computational framework A common approach in natural language understanding systems is to use one computational paradigm for syntactic analysis (e.g DCGs, ATNs) and another one for semantic analysis ... non-predicate variables This is because such variables m a y appear inside the terms of a goal as well as the head of a goal In a sense, they can be used intensionally and extensionally (or nominally and ... that every formula, A, can be converted to a A-normal formula that is unique up to aconversions We call such a formula a A-normal form of A and we use Anorrn (A) to denote any of these alphabetic...
Ngày tải lên: 21/02/2014, 20:20
Higher-Order Perl pdf
... lists, for a total of · = 24 total orders: D ABC A D BC D ACB A D CB D BAC B D AC D BCA B D CA D CAB C D AB D CBA C D BA AB D C AC D B BA D C BC D A CA D B CB D A ABC ACB BAC BCA CAB CBA D D D D ... functions have this behavior by default, unless declared otherwise (In C, such variables are called auto variables, because they are automatically allocated and deallocated.) Using global variables ... as trademarks or registered trademarks In all instances in which Morgan Kaufmann Publishers is aware of a claim, the product names appear in initial capital or all capital letters Readers, however,...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx
... 2003) Approaches that thrive in one domain may dramatically flounder in others So, whether a particular computational model is successful as a model of natural language acquisition is ultimately an ... Obligatory Wh movement The Language Domain Database The focus of the language domain database, (hereafter LDD), is to make readily available the different word order patterns that children are ... settings and annotations are saved and available the next time the user logs on Finally on the Data Download page, users may download data so that they can use the patterns and derivations offline...
Ngày tải lên: 08/03/2014, 04:22
Being Born Under Adverse Economic Conditions Leads to a Higher Cardiovascular Mortality Rate Later in Life: Evidence Based on Individuals Born at Different Stages of the Business Cycle pdf
... HV Amsterdam The Netherlands E-mail: gjvdberg@xs4all.nl * We thank Angus Deaton, Hans Christian Johansen, Adriana Lleras-Muney, Bernard van Praag, Andreas Wienke, and participants at seminars at ... parameter λ and shape parameter k0 , and W has a Gamma distribution with scale parameter λ and shape parameter kω It can be shown that Vi := Vi0 +W then has a Gamma distribution with scale and ... main death causes: “cardiovascular” (death due to cardiovascular malfunctions or diseases, including apoplexy),6 “cancer” (death due to malignant neoplasms or congenital malformations - the latter...
Ngày tải lên: 17/03/2014, 08:20