solutions with a combination of sodium chloride and dextrose
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality of Life Outcomes ... who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the scales Finally, although ... correlations were also found between the MSRMS subscales and the SF-36 scale, and between the MSRMS subscales and the EDSS Table Data quality, scaling assumptions, acceptability, and reliability of...
- 8
- 492
- 0
Báo cáo y học: "A proposed algorithm for initiation of renal replacement therapy in adult critically ill patients" pps
... No Bagshaw et al Table A summary of absolute or ‘rescue therapy’ indications for initiation of renal replacement therapy in critically ill patients Category Characteristic Metabolic Azotemia Serum ... class F Patients achieving RIFLE class F had a far worse clinical outcome, characterized by an adjusted hazards ratio for hospital death of 2.7 (95% CI, 2.0 to 3.6) and longer durations of stay ... of renal replacement therapy initiation in acute renal failure: a meta-analysis Am J Kidney Dis 2008, 52:272284 Splendiani G, Mazzarella V, Cipriani S, Zazzaro D, Casciani CU: Continuous renal...
- 8
- 208
- 0
Báo cáo y học: "Late initiation of renal replacement therapy is associated with worse outcomes in acute kidney injury after major abdominal surgery" potx
... major abdominal surgery Materials and methods Study populations This study was based on the National Taiwan University Surgical ICU Associated Renal Failure (NSARF) Study Group database The database ... timing of RRT initiation in severe AKI and prognoses Timing of RRT was assessed by several approaches such as median value and median change of BUN and sCr, and the period from ICU admission to start ... hospital admission to RRT initiation, as well as the severity scores including APACHE II score and SOFA score and almost all clinical parameters upon RRT initiation, which was taken as a starting...
- 11
- 404
- 0
Báo cáo y học: "Correlation between parameters at initiation of renal replacement therapy and outcome in patients with acute kidney injury" ppsx
... breach of privacy or anonymity Statistical analysis Demographic data were presented as mean ± standard deviation and 95% confidence intervals (CI) or median and range Statistical significance was ... Additional data file 1), a table that lists the correlation between different combinations of parameters at time of RRT and hospital mortality (Table S2 in Additional data file 1), and an additional ... start of RRT were associated with a worse outcome in AKI patients [11,22,23] Bagshaw and colleagues analysed the data of 1260 ICU patients treated with RRT and found that the median serum creatinine...
- 13
- 263
- 0
Báo cáo y học: "Initiation of renal replacement therapy: is timing everything" potx
... conventional renal criteria (creatinine and diuresis) are a poor reflection of AKI and not differentiate between pre-renal failure and intrinsic renal damage Early initiation of RRT in pre-renal failure ... JA: External validation of severity scoring systems for acute renal failure using a multinational database Crit Care Med 2005, 33:1961-1967 Bouman CS, Oudemans-van Straaten HM: Timing of renal ... We shall have to wait and see Abbreviations AKI = acute kidney injury; ICU = intensive care unit; RRT = renal replacement therapy Author details Department of Intensive Care, Academic Medical Center,...
- 2
- 148
- 0
Báo cáo y học: "Endothelial A comparison of early versus late initiation of renal replacement therapy in critically ill patients with acute kidney injury: a systematic review and meta-analysis" pdf
... extracted data, performed statistical analysis and tabulated quality indicators of the studies IS and SM carried out the primary study search and extracted data AL carried out statistical analysis and ... any discrepancies Data were collected on study characteristics and quality, demographics and baseline characteristics (that is, clinical/biochemical parameters at initiation of RRT), and details ... meta-analyses Additional File 2: Summary of search strategy Detailed summary of search terms and strategy used for systematic literature search Abbreviations AKI: acute kidney injury; AKIN: Acute...
- 10
- 411
- 0
báo cáo hóa học:"Early initiation of antiretroviral therapy results in decreased morbidity and mortality among patients with TB and HIV" ppt
... design of the study, collecting data, analyzing and preparing the manuscript AS participated in collecting data and preparing the manuscript PB participated in collecting data and analyzing data MP ... 2005, HAART was initiated with zidovudine, lamivudine and nelfinavir At the time of HAART initiation, administration of rifampin, as part of CAT-1 treatment, was changed to rifabutin, 150 mg daily ... The research was approved and conducted in accordance with an institutional review board Statistical data analysis was performed using SPSS v 13.0 software (Apache Software Foundation, Chicago,...
- 6
- 310
- 0
Báo cáo khoa học: "Mitochondrial DNA alterations of peripheral lymphocytes in acute lymphoblastic leukemia patients undergoing total body irradiation therapy" ppt
... 5'–CTTACACTATTCCTCATCACCCAACTAAAAA–3'), reverse primer (ß-actin: 5'–TGGCATTGCCGACAGGAT–3'; HVR2: 5'–GTTTAAGTGCTGTGGCCAGAAG–3'; CD: 5'–GGAGTAGAAACCTGTGAGGAAAGG–3') and TaqMan MGB hybridization probes ... total amount of mtDNA since this region is relatively conserved in Han Chinese [19] The forward primer (ß-actin: 5'–AGGACCCTGGATGTGACAGC–3'; HVR2: 5'–GCTTTCCACACAGACATCATAACAA–3'; CD: 5'–CTTACACTATTCCTCATCACCCAACTAAAAA–3'), ... Co (Osaka, Japan) Each reaction was carried out in total volume of 25 µl with 50 ng total DNA template, 300 nM each primer, and 100 nM TaqMan-MGB probe After an initial denaturation step at 94oC...
- 25
- 227
- 0
Báo cáo y học: "arly development of non-hodgkin lymphoma following initiation of newer class antiretroviral therapy among HIV-infected patients - implications for immune reconstitution" pps
... integrase inhibitors have a mechanism of action similar to recombinationactivating genes and (RAG1/2), a recombinase complex fundamental to V(D)J recombination in the assemblage of human immunoglobulins, ... concept and design, carried out acquisition, analysis, and interpretation of the data, and provided administrative, technical or material support for the study SV carried out acquisition of the data ,and ... and interpretation of the data, drafted the manuscript, supervised the study, and takes responsibility for the integrity of the data and the accuracy of the data analysis SM participated in the...
- 8
- 300
- 0
Báo cáo y học: " Dental problems delaying the initiation of interferon therapy for HCV-infected patients" pptx
... alveolar abscess of bilateral mandibular molars, #2 Periodontal diseases of the right mandibular first and second molars, the left mandibular first molar, and the left maxilla first and second molars ... alfa-2b/RBA®Peg-IFN alfa- 2a monotherapy (0.7%) Peg-IFN alfa-2b/RBA®Peg-IFN alfa- 2a monotherapy®Peg-IFN alfa- 2a/ RBA (0.2%) Peg-IFN alfa-2b/RBA®Peg-IFN alfa- 2a monotherapy®Peg-IFN alfa-2b/RBA (0.2%) Peg-IFN alfa- 2a/ RBA ... Technology of Japan, and was supported in part by Health and Labour Sciences Research Grants for Research on Hepatitis from the Ministry of Health, Labour and Welfare of Japan 12 13 14 Author details...
- 5
- 223
- 0
Báo cáo y học: " Change in CD3 positive T-cell expression in psoriatic arthritis synovium correlates with change in DAS28 and magnetic resonance imaging synovitis scores following initiation of biologic therapy-a single centre, open-label study" doc
... compared to the anakinra group Nineteen of the 25 patients achieved an improvement in DAS28 of >1.2 and are labelled responders (5 anakinra and 14 etanercept), and patients did not and are labelled ... 66.6% female, had a mean age (range) of 43.2 (27 to 60) and 48.7 (26 to 64) years and a mean disease duration of 9.1 (1 to 42) and 7.5 (1 to 29) years in the anakinra and etanercept treated cohorts, ... achieved a ΔDAS28 of 1.22 and ΔCD3 of 19, and Patient (anakinra) achieved a ΔDAS28 of 0.16 and ΔCD3 of -118 There was a significant correlation between ΔCD3 and ΔMRI synovitis following treatment...
- 10
- 358
- 0
Báo cáo y học: "Evaluation of maternal infusion therapy during pregnancy for fetal development"
... CAs (such as congenital dislocation of hip based on Ortolani click, congenital inguinal hernia, and large haemangioma), minor anomalies-variants (e.g., umbilical hernia, hydrocele, small haemangioma) ... confounding factors, as maternal age, birth order, marital and employment status of mothers (as indicators of socioeconomic status), pregnancy complications and drug uses were evaluated Statistical analysis ... group of total CAs, and within them, of hypospadias and multiple CAs Thus, we were not able to detect any teratogenic potential of infusion treatment during pregnancy On the other hand, mean gestational...
- 6
- 479
- 0
Tài liệu THE SHOES OF FORTUNE (IV) pptx
... they are afraid of my beak; and I have always a witty answer at hand Come, let us be men!’ ‘O warm spicy land of my birth,’ sang the Canary bird; ‘I will sing of thy dark-green bowers, of the calm ... looking with a benignant smile at a large green parrot that swung himself backwards and forwards most comfortably in his ring, inside a magnificent brass-wired cage ‘To-day is Polly’s birthday,’ said ... treatment I know I am a clever fellow; and that is all I care about Come, let us be men You are of a poetical nature, as it is called—I, on the contrary, possess profound knowledge and inexhaustible...
- 14
- 493
- 0
Tài liệu Copy of C IV tiep-tph ppt
... thiếu thốn tình cảm, thiếu chia sẻ, tâm Đ a trẻ camt thấy cô đơn gia đình Gia đình thiếu tôn trọng lẫn Bố, mẹ thường xuyên đánh chửi nhau: Đ a trẻ coi thường dạy bảo cha mẹ, không lời xã hội thiếu ... với đ a trẻ, thường xuyên đánh mắng…sẽ làm cho đ a trẻ cảm thấy xa cách với bố mẹ, cảm thấy bất công, chán nản Gia đình không đầy đủ (những gia đình lí li hôn, li thân, bố hay mẹ chết tai nạn, ... nhân tai nạn (thiên tai, lao động…) Nạn nhân tội phạm Cá nhân + Tổ chức Cá nhân (con người) VAI TRÒ C A NẠN NHÂN TRONG CƠ CHẾ THỰC HIỆN HÀNH VI PHẠM TỘI Cơ chế thực hành vi phạm tội đầy đủ bao gồm...
- 48
- 416
- 1
Tài liệu Linux Device Drivers-Chapter 15 :Overview of Peripheral Buses pdf
... important and you want to support old motherboards, an ISA implementation is preferable to PCI An additional advantage of this old standard is that if you are an electronic hobbyist, you can easily ... devices, and each device can be a multifunction board (such as an audio device with an accompanying CDROM drive) with a maximum of eight functions Each function can thus be identified at hardware ... the minimal overhead of dereferencing a pointer to the normal overhead of a function call In the case of PCI management, the only hardware-dependent operations are the ones that read and write...
- 69
- 341
- 0
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt
... Walborg EF Jr (1983) Characterization of a family of glycoproteins associated with the bile canalicular membrane of normal hepatocytes but not expressed by two transplantable rat hepatocellular ... intermediate and heavy endosomes (Li ⁄ Lh) fractions [49] Li is a homogeneous fraction containing late endosomes and a negligible amount of the marker enzymes sialyl transferase and galactosyl transferase ... Kameoka J, Tanaka T, Nojima Y, Schlossman SF & Morimoto C (1993) Direct association of adenosine deaminase with a T cell activation antigen, CD26 Science 261, 466–469 Girardi AC, Degray BC, Nagy...
- 12
- 738
- 0
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf
... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... N-terminal leucine amino acid Our present study indicates that nonAUG translation initiation may be operable more often than anticipated This may have a great impact on the analysis of genes...
- 11
- 469
- 0
Basic Principles of Peripheral Nerve Disorders Edited by Seyed Mansoor Rayegani docx
... bodies of sensory and motoneurons, axons and Schwann cells (Fukaya et al., 2003; Akazawa et al., 2004) GAL-1 mRNA persists in DRG neurons at later developmental stages and is maintained in adult ... cross-anastomosed and grafted myelinated and unmyelinated nerves: quantitative microscopy and radioautography.” Brain Research 104 (1) (March 5): 1-20 Armati, Patricia 2007 The biology of Schwann ... important and critical to distinguish between neurapraxia (conduction block/demyelination) and axonal damage In Axonal damage Wallerian degeneration is progressed toward the muscle end organ and...
- 288
- 1,115
- 0
Báo cáo khoa học: Alternative initiation of transcription of the humanpresenilin 1gene in SH-SY5Y and SK-N-SH cells The role of Ets factors in the regulation ofpresenilin 1 pptx
... days before transfecGCAGCTC-3¢) and p+20R; m(+65) with p+65F tion On the day of transfection, medium was replaced with (5¢-GCGGTTTCACATCCTAGACAAAACAGCG-3¢) and serum-free Dulbecco’s modified Eagle’s ... GGTACTAACCTGAACAAGA-3¢ For b-galactosidase assays 12–20 lg of protein extract PCR conditions were according to the manufacturer’s (non heat-treated) was incubated in 0.1 M sodium phosrecommendations ... initiation of shorter transcripts may have implications for additional regulation at the level of translation The 5¢-UTR of PS1 mRNA appears to be naturally unfavorable for translation, due to a...
- 10
- 492
- 0
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt
... beforehand with a primase assay on poly (dT) Lanes and 2, control reaction with DNA polymerase a- primase lacking TAg or vice versa; lanes and 4, 0.2 U and 0.4 U of human; lanes and 6, 0.2 U and ... [a3 2P]dCTP and [a3 2P]dTTP (3000 CiÆmmol)1, AmershamBiosciences) DNA polymerase a- primase was added as indicated The incorporation of radioactive dNMP was measured by acid-precipitation of DNA and scintillation ... to Bradford [41] using a commercial reagent with BSA as a standard (Biorad, Munich) DNA polymerase a and DNA primase assays were performed as previously described [34,42,43] Preparation of S100...
- 8
- 326
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008