solutions and route of developing card of nam a bank

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

... e-max ELISA reader and analyzed with Softmax Pro software (both Molecular Devices, Sunnyvale, CA) Statistical analyses Prism software [64] was used for plotting and statistical analysis of data ... Tamura S, Funato H, Hirabayashi Y, Kikuta K, Suzuki Y, Nagamine T, Aizawa C, Nakagawa M, Kurata T: Functional role of respiratory tract haemagglutinin-specific IgA antibodies in protection against ... influenza Vaccine 1990, 8:479-485 Tamura SI, Asanuma H, Ito Y, Hirabayashi Y, Suzuki Y, Nagamine T, Aizawa C, Kurata T, Oya A: Superior cross-protective effect of nasal vaccination to subcutaneous...

Ngày tải lên: 18/06/2014, 18:20

14 516 0
Báo cáo hóa học: " Research Article Existence of Solutions and Convergence of a Multistep Iterative Algorithm for a System of Variational Inclusions with (H,η)-Accretive Operators" pot

Báo cáo hóa học: " Research Article Existence of Solutions and Convergence of a Multistep Iterative Algorithm for a System of Variational Inclusions with (H,η)-Accretive Operators" pot

... of Inequalities and Applications [11] S Adly, “Perturbed algorithms and sensitivity analysis for a general class of variational inclusions,” Journal of Mathematical Analysis and Applications, ... system of nonlinear variational inequalities As generalizations of the above systems of variational inequalities, Agarwal et al [33] introduced a system of generalized nonlinear mixed quasivariational ... inclusions,” Applied Mathematics and Computation, vol 145, no 2-3, pp 795–803, 2003 [2] A Hassouni and A Moudafi, A perturbed algorithm for variational inclusions,” Journal of Mathematical Analysis and Applications,...

Ngày tải lên: 22/06/2014, 19:20

20 366 0
The Geographic Distribution and Characteristics of U.S. Bank Failures, 2007-2010: Do Bank Failures Still Reflect Local Economic Conditions? pptx

The Geographic Distribution and Characteristics of U.S. Bank Failures, 2007-2010: Do Bank Failures Still Reflect Local Economic Conditions? pptx

... Neely, and Wheelock (2009) for a discussion of systemic risk and the financial crisis of 2008-09 11 JPMorgan Chase, Bank of America, Citibank, Wachovia Bank, and Wells Fargo Bank had more total assets ... the failure of thousands of banks located in farm states and other rural areas States where farm land values and cultivated acreage had expanded the most during boom years surrounding World War ... State 23 State-level data on real estate loans attribute all of a bank s loans to the state in which the bank is headquartered Branch-level loan data are not available We report data for all insured...

Ngày tải lên: 06/03/2014, 10:20

22 496 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

... CGTases; yellow, acarviose transferase; pink, maltogenic a- amylase; blue, a- amylases from Bacillus and actinomycetes; light blue, a- amylases from fungi and yeast; green, maltotetraohydrolases and ... [86] Maltotetrao-hydrolase Maltopentao-hydrolase Maltogenic a- amylase Acarviose transferase Cyclodextrin glucanotransferase a The accession numbers with * are the numbers from GenBank Results and ... the a- amylase family, this module has been recognized in enzymes having six of the almost 30 specificities: a- amylase, maltotetraohydrolase, maltopentaohydrolase, maltogenic a- amylase, CGTase, and...

Ngày tải lên: 08/03/2014, 08:20

11 616 0
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

... [28] and PROCHECK [29] In each case, the stereochemical quality and the Ramachandran [30] scores were good and similar to that of the template Docking of Pi4 on rat Kv1.2 channel The experimental ... bioassays, we tested sPi4 rather than its natural counterpart as the latter is present in too low abundance in the venom of scorpion P imperator to allow a detailed analysis of its structural and ... (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine receptors FEBS Lett 469, 179–185 Mosbah, A. , Kharrat, R., Fajloun, Z.,...

Ngày tải lên: 17/03/2014, 10:20

10 503 0
Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

... Substrate VanXYCa D59S D5 9A VanXYCa D59S D5 9A D-Ala-D-Ala a D-Ala-D-Ala D-Ala-D-Ala UDP-MurNAc-pentapeptide[Ala] UDP-MurNAc-pentapeptide[Ala] UDP-MurNAc-pentapeptide[Ala] Km (mM) kcat (s)1) kcat/Km ... as follows; Pfu polymerase (Stratagene) was used to amplify vanXYC using pAT704 as template with primers A (5¢-GCTAGGTCTCAATGAAC ACATTACAATT-3¢) and B (5¢-TATGGAATTCTCATG CGAACTGCCTCA-3¢) that ... Lessard, I .A. D & Walsh, C.T (1999) Mutational analysis of active-site residues of the enterococcal D-Ala-D-Ala dipeptidase VanX and comparison with Escherichia coli D-Ala-D-Ala ligase and D-Ala-D-Ala...

Ngày tải lên: 18/03/2014, 01:20

7 414 0
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢ b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢ c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and 5¢-T ... produce a PCR product of 513 bp containing the transmembrane domain: 5¢-CATCC ATAGCAGATAACAGTC-3¢ (forward) and 5¢-TCCCA AAGCTCATGTCATAAG-3¢ (reverse) corresponding to amino-acid residues S(123)SIADNSL(130) ... poly (A) signals [A( 1259)TAAA and A( 1430)ATTAAA] giving rise to poly (A) tails were observed by PCR-screening of the bovine mammary gland cDNA library The N-terminal amino-acid sequencing of purified...

Ngày tải lên: 24/03/2014, 04:21

9 614 0
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx

Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx

... oleic acid [2] The complex was named HAMLET and was defined as a complex between partially unfolded a- lactalbumin and oleic acid Human a- lactalbumin is a globular 14.2 kDa milk protein (123 amino acids), ... side chains of asparagines 82, 84, 87 and 88 and lysine 79 [14] The a- helical domain contains three major ahelical (amino acids 5–11, 23–34 and 86–98) and two short 310-helical domains The smaller ... Hospital Foundation, Royal Physiographic Society, Anna-Lisa, Sven-Erik Lundgren Foundation, Knut and Alice Wallenberg Foundation, Inga-Britt and Arne Lundbergs Foundation and the John and Augusta...

Ngày tải lên: 29/03/2014, 21:20

12 526 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG ... (Table ) Loop (9–12) and loop (18–23) create a b-turn A characteristic of the PAF loop regions is the recurring asparagine–aspartate or aspartate–asparagine (Asn18– Asp19, Asp32–Asn33, Asp39–Asn40)...

Ngày tải lên: 29/03/2014, 23:20

16 409 0
Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

... Giancola C & Graziano G (1993) THESEUS: a new software package for the handling and analysis of thermal denaturation data of biological macromolecules J Thermal Anal 38, 2779–2790 37 Kraulis PJ (1991) ... S rather than that of a mammalian crystallin such as cS-crystallin, a qualitative, indirect indication of a closer structural relationship between geodin and protein S Geodin also displays a single ... bc-crystallin superfamily Geodin is a monomeric, two-domain protein, made up of b strands apparently folded in Greek-key motifs, just as its mammalian, amphibian and bacterial homologues Of particular...

Ngày tải lên: 30/03/2014, 15:20

13 442 0
Báo cáo khoa học: "Alternative low doses and routes of administering a prostaglandin F2α analogue to induce luteolysis in Nelore cows" ppt

Báo cáo khoa học: "Alternative low doses and routes of administering a prostaglandin F2α analogue to induce luteolysis in Nelore cows" ppt

... gnirapmoc ,ahpla2F nidnalgatsorp htiw surtse dellortnoc ro larutan a retfa elttac ubeZ ni lairt ytilitreF R orreiF-orravaN ,A uaetahcuD ,SC anilaG ,C ravidnaL 61 4991 ,ateloG ,snoitacilbuP yranireteV ... noitanimesni laicifitrA JM sdleiF ,CA kcinraW ,RD nidraH 21 917-517 ,75 ,5002 cetooZ teV deM sarB qrA anivob aemêf ad latineg ỗgró od asonev arutetiuqraoignA DJ seãramiuG ,RAT aluaP ,CAC sednanreF ... slamina mraf ni pihsnoitaler nairavoretu cimetsys susrev lacoL JO rehtniG a 012-102 ,22 ,8991 laminA oóỗudorpeR ed arielisarB atsiveR riG a ar ad sacav me oóỗaluvo ad oóỗazinorcnis e ralucilof acimâniD...

Ngày tải lên: 07/08/2014, 18:21

4 223 0
Báo cáo y học: "Biologic activity and safety of belimumab, a neutralizing anti-B-lymphocyte stimulator (BLyS) monoclonal antibody: a phase I trial in patients with systemic lupus erythematosus" potx

Báo cáo y học: "Biologic activity and safety of belimumab, a neutralizing anti-B-lymphocyte stimulator (BLyS) monoclonal antibody: a phase I trial in patients with systemic lupus erythematosus" potx

... SLE patients with active production of anti-nuclear autoantibodies (ANA) have distinct patterns of lupus activity and peripheral B-cell biomarkers compared to ANA negative patients [abstract] Ann ... years) Half of the patients were white, and 47% of patients were African American; all treatment groups included patients of Hispanic origin The median duration of disease was 6.5 years (range ... Anti-dsDNA antibodies and ANAs were measured by Farr assay (Specialty Laboratories, Santa Monica, CA, USA) and indirect fluorescent antibody assay (FOCUS Diagnostics, Herndon, VA, USA), respectively...

Ngày tải lên: 09/08/2014, 13:21

15 478 0
Báo cáo y học: "Ethnomedicine and ethnobotany of fright, a Caribbean culture-bound psychiatric syndrome" ppsx

Báo cáo y học: "Ethnomedicine and ethnobotany of fright, a Caribbean culture-bound psychiatric syndrome" ppsx

... a backache treatment throughout the area French Guianese and several native Guiana groups (Caribs and Arawaks in Surinam; Palikur and Wayapi in French Guiana, Patamona in Guyana) boil G barbadense ... stomach problems and as sedatives ([80] and [84] for review of L alba in South America) For example, Jamaicans use L alba for insomnia [5], and Brazilians use L alba and L geminata as sedatives ... Drosophila melanogaster” British Journal of Pharmacology 2003, 140:1363-1372 103 Watanabe M, Maemura K, Kanbara K, Tamayama T, Hayasaki H: “GABA and GABA receptors in the central nervous system and other...

Ngày tải lên: 10/08/2014, 09:21

18 333 0
báo cáo khoa học: " If you build it, they still may not come: outcomes and process of implementing a community-based integrated knowledge translation mapping innovation" pps

báo cáo khoa học: " If you build it, they still may not come: outcomes and process of implementing a community-based integrated knowledge translation mapping innovation" pps

... between the manager and the data analyst about their individual and organizational needs around mapping and maps, and then make any system barriers to using local data and maps more transparent for ... piece of paper and that's, that's a limiting factor.' (Data Analyst) Most of the data analysts did not have formal training as geographers The creation and use of maps as a tool for data analysis ... tutorial was presented, with one exception, all of the data analysts that Page of 13 Table 2: Dose of interventions received by OEYC dyads Data Analyst/ Manager Dyads A (Data Analyst) A (Manager)...

Ngày tải lên: 10/08/2014, 10:23

13 300 0
báo cáo khoa học: " NAOMI: The trials and tribulations of implementing a heroin assisted treatment study in North America" ppsx

báo cáo khoa học: " NAOMI: The trials and tribulations of implementing a heroin assisted treatment study in North America" ppsx

... approved and, at this point, only have approval for a RCT using MMT as an active comparator In Switzerland, the provision of HAT was approved after a referendum was passed and the German trial went ahead ... Health Canada, has denied compassionate access use to DAM, HAT treatment is unavailable in Canada Canada is the only country where diamorphine has been tested for addiction treatment and has ... increased incidence of HIV/AIDS and Hepatitis, increased hospital and emergency service utilization for treatment of HIV-related diseases, septicaemia and endocarditis, as well as increased ambulance...

Ngày tải lên: 11/08/2014, 18:20

14 302 0
báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf

báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf

... 5’TAAGATTTGGCCTCCTCCTG-3’ and FLS-R, 5’ACCAAGCCCAAGTGATAAGC-3’; F3H-F, 5’AGTGGTGAATTCGAATAGCAGTAG-3’ and F3H-R, 5’-TTTCCTCCTGTACATTTCTGCAA-3’; F3’H-F, 5’GAGGAGTTCAAGTTAATGGTGGT-3’ and F3’H-R, 5’-ACTCGCTTTTCCTTGTGTTCTT-3’; ... to make the primer 75ALerevECO (GGAATTCTCAGCAACGATAAACGTCCAAAGATAG) with an additional EcoRI site for the 3’ end of the gene The 5’ end primer, 75ALedirBAM (GGGATCCATGGCGTTACGTATTAATGAGTTATTT), ... Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J: qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data Genome...

Ngày tải lên: 12/08/2014, 03:21

12 434 0
Báo cáo y học: " Panorama phylogenetic diversity and distribution of type A influenza viruses based on their six internal gene sequences" pptx

Báo cáo y học: " Panorama phylogenetic diversity and distribution of type A influenza viruses based on their six internal gene sequences" pptx

... read and approved the final manuscript Additional material Additional file The designations and alignment of the representative sequences of PB2 gene The data could be read out with NotePad and ... pintail (Anas acuta) Mol Ecol 2008, 17:4754-4762 Cattoli G, Monne I, Fusaro A, Joannis TM, Lombin LH, Aly MM, Arafa AS, Sturm-Ramirez KM, Couacy-Hymann E, Awuni JA, Batawui KB, Awoume KA, Aplogan ... Organization and has spread to many countries Some experts claimed that the virus was an unusually mongrelized mix of human, avian and swine influenza viruses with the PB2 and PA genes from avian...

Ngày tải lên: 12/08/2014, 04:20

17 353 0
Báo cáo khoa học: " Panorama phylogenetic diversity and distribution of type A influenza viruses based on their six internal gene sequences" pdf

Báo cáo khoa học: " Panorama phylogenetic diversity and distribution of type A influenza viruses based on their six internal gene sequences" pdf

... read and approved the final manuscript Additional material Additional file The designations and alignment of the representative sequences of PB2 gene The data could be read out with NotePad and ... pintail (Anas acuta) Mol Ecol 2008, 17:4754-4762 Cattoli G, Monne I, Fusaro A, Joannis TM, Lombin LH, Aly MM, Arafa AS, Sturm-Ramirez KM, Couacy-Hymann E, Awuni JA, Batawui KB, Awoume KA, Aplogan ... Organization and has spread to many countries Some experts claimed that the virus was an unusually mongrelized mix of human, avian and swine influenza viruses with the PB2 and PA genes from avian...

Ngày tải lên: 12/08/2014, 04:20

17 272 0

Bạn có muốn tìm thêm với từ khóa:

w