... but has bad sectors, try Scandisk (thorough option) or Norton Utilities Disk Doctor A bad sector can make a bad day too And a rule of thumb for bad sectors, even one grown bad sector means there ... computer parts If the data is good, send the new HDA and bad board back to be fixed, put the good drive (with original data) back in, reboot, and away you go Page 20 200 ways to revive a hard drive ... Fortunately, once was enough in this case The data was backed up to a portable tape drive and the C drive was replaced and restored From: Sam Espana I have used several ways to solve the same issue...
Ngày tải lên: 22/12/2013, 19:15
... but has bad sectors, try Scandisk (thorough option) or Norton Utilities Disk Doctor A bad sector can make a bad day too And a rule of thumb for bad sectors, even one grown bad sector means there ... computer parts If the data is good, send the new HDA and bad board back to be fixed, put the good drive (with original data) back in, reboot, and away you go Page 20 200 ways to revive a hard drive ... Fortunately, once was enough in this case The data was backed up to a portable tape drive and the C drive was replaced and restored From: Sam Espana I have used several ways to solve the same issue...
Ngày tải lên: 26/12/2013, 01:16
Tài liệu 200 Ways to revive a hard drive pdf
... but has bad sectors, try Scandisk (thorough option) or Norton Utilities Disk Doctor A bad sector can make a bad day too And a rule of thumb for bad sectors, even one grown bad sector means there ... computer parts If the data is good, send the new HDA and bad board back to be fixed, put the good drive (with original data) back in, reboot, and away you go Page 20 200 ways to revive a hard drive ... Fortunately, once was enough in this case The data was backed up to a portable tape drive and the C drive was replaced and restored From: Sam Espana I have used several ways to solve the same issue...
Ngày tải lên: 27/01/2014, 05:20
200 ways to revive a hard driver
... but has bad sectors, try Scandisk (thorough option) or Norton Utilities Disk Doctor A bad sector can make a bad day too And a rule of thumb for bad sectors, even one grown bad sector means there ... computer parts If the data is good, send the new HDA and bad board back to be fixed, put the good drive (with original data) back in, reboot, and away you go Page 20 200 ways to revive a hard drive ... Fortunately, once was enough in this case The data was backed up to a portable tape drive and the C drive was replaced and restored From: Sam Espana I have used several ways to solve the same issue...
Ngày tải lên: 23/08/2012, 09:43
Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP
... conventional parameter apparatus such as temperature, pH and conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, ... WWTPs have their own data management systems, such as SCADA (Supervisor, Control and Data Acquisition) and control system with the function to pick up the analysis data and control the automatic ... which means to adjust the parameters and calibrate the model to adapt the practical process The WWTP software should be setup according to the process of real plant according to the abstracted...
Ngày tải lên: 05/09/2013, 09:08
báo cáo hóa học: "Learning to perform a new movement with robotic assistance: comparison of haptic guidance and visual demonstration" pptx
... the hand path evolved systematically toward an attractor path during "forgetting" then this measure should have decreased systematically (as the hand path was drawn toward the attractor path) ... 2001:14-17 Marayong P, Okamura AM: Speed-accuracy characteristics of human-machine cooperative manipulation using virtual fixtures with variable admittance Hum Factors 2004, 46:518-532 Bettini A, Marayong ... learning with haptic guidance to date examined the ability of healthy subjects to learn a complex trajectory with haptic guidance and/or visual demonstration [7] A robotic device was used to...
Ngày tải lên: 19/06/2014, 10:20
How to Make A Small Fortune with Tiny Little $7 Products By Jason Fladlien pot
... that has all the good stuff in it organized in an easy to understand way and that people can reference That's EASILY worth $7 More to the point - it's easier for you to research and create a ... use a program like Rapid Action Profits to set it up so that an affiliate gets instantly paid into their PayPal account 100% of the $7 sale Why would you go and that? Are you crazy? Only like a ... related to WordPress And see what questions come up over and over and over again Then you create a report Each short chapter is an answer to a major problem people keep asking over and over again...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo y học: "A successfully thrombolysed acute inferior myocardial infarction due to type A aortic dissection with lethal consequences: the importance of early cardiac echocardiography" ppsx
... of a valved-graft A coronary artery bypass grafting with a saphenous vein graft anastomosed in the right coronary artery at the level of the crux was also done The patient was rewarmed and weaned ... substantial contributions of data analysis, AM has made substantial contributions to design the manuscript and DA has made substantial contribution to design and has given the final approval of ... C: Proximal aortic dissection with coronary malperfusion: presentation, management and outcome C J Thorac Cardiovascular Surg 2001, 121:552-60 Kawahito K, Adachi H, Murata S, Yamaguchi A, Ino T:...
Ngày tải lên: 10/08/2014, 09:22
Applied Software Project Management - HOW TO DIAGNOSE AND FIX A TROUBLED SOFTWARE PROJECT pptx
... critical path analysis can help spot problems early on 14 Applied Software Project Management PROBLEMS ARE FOUND TOO LATE There are preventable defects in the software that aren’t caught until late ... transparency, by letting the team correct each other in an open meeting 10 Applied Software Project Management WORKING BACKWARDS FROM A DEADLINE Project managers approach a non-negotiable deadline ... Applied Software Project Management LACK OF LEADERSHIP It takes more than a talented and motivated team to make a successful project Lack of leadership manifests itself in the team members...
Ngày tải lên: 28/06/2014, 07:20
How to setup a Linux system that can boot directly from a software RAID
... the partitioning utility to create the software RAID partitions In the example both disks are split into a 3498Mb and a 596Mb software RAID partitions: Device Type Size Mbytes /dev/hda1 software ... software RAID 3498 /dev/hda2 software RAID 596 /dev/hdc1 software RAID 3498 /dev/hdc2 software RAID 596 If the disks are new, the partitioning utility will ask to create a new partition table If ... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software...
Ngày tải lên: 18/09/2012, 10:11
Development of a method to measure consumer emotions associated with foods
... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... Sensation seeking and positive affect 1.4 Facial scaling Another approach to measuring emotions has been the use of facial scaling A number of different systems for facial scaling have recently appeared...
Ngày tải lên: 03/04/2013, 21:07
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... time available/ in the available time.(1) We have to exploit all available potential/ all potential available in our country (2) As we know that when changing the position of adjective available ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...
Ngày tải lên: 10/04/2013, 14:46
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
... Sundays, many families have a traditional meat at home: grilled meat with potatoes, vegetables and gravy For many English people, dinner is a main meal and the whole family often have dinner together ... by an amount of water or steam in a confined space For example: They kept up a good head of steam 16 (in place names) a headland For example: Beach head 17 A main division in a lecture, an essay, ... Similarly, when we say not beat a dead horse we not refer to a carcass of a certain kind of animal but what we mean is that a person should not waste time thinking of an issue that has already...
Ngày tải lên: 20/12/2013, 18:33
Tài liệu A Practical Guide to Business Continuity & Disaster Recovery with VMware Infrastructure docx
... virtual hardware resources, as well as an operating system and all its applications, inside a software package Encapsulation makes virtual machines incredibly portable and easy to manage, and VMware ... from an operational failback Capacity Management Capacity management was a concern; for example, what happens if an operational load is moved to a second site with its own operational load? Network ... virtual machines and associated storage that can be failed over to an alternative site The LUNS/VMFS’ associated with a protection group are assumed to be replicated at the array level and in...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt
... Y and Maeda E 2003 Hierarchical Directed Acyclic Graph Kernel: Methods for Structured Natural Language Data ACL-2003 Zelenko D., Aone C and Richardella A 2003 Kernel Methods for Relation Extraction ... 2004 data shows consistent better performance on all setups than the 2003 data although the ACE 2003 data is two times larger than the ACE 2004 data This may be due to two reasons: 1) The ACE 2004 ... POS tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model Feature-based methods (Kambhatla, 2004; Zhou et al., 2005; Zhao and Grishman, 20052...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo " A method to construct flood damage map with an application to Huong River basin, in Central Vietnam" pdf
Ngày tải lên: 05/03/2014, 16:20
Producing Open Source Software - How to Run a Successful Free Software Project pptx
... was always an impedance to sharing, an impedance proportional to the distance (real or organizational) that the software had to travel Widespread, frictionless sharing, as we know it today, was ... are organizations in whose interest it is to have certain software exist, but that they don't need to sell copies, they just want to make sure the software is available and maintained, as a tool ... power was becoming a fungible good, while software was becoming the differentiator Selling software, or at least treating it as an integral part of hardware sales, began to look like a good strategy...
Ngày tải lên: 06/03/2014, 01:22
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf
... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... with an N-terminal leucine amino acid Our present study indicates that nonAUG translation initiation may be operable more often than anticipated This may have a great impact on the analysis of genes...
Ngày tải lên: 07/03/2014, 10:20