sofcs offer a number of adv

current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

... FSoft has established FPT Software Japan, Ltd with its headquarters in Tokyo and a representative office in Osaka, Japan Following the success of FPT Software Japan, FPT Software APAC was established ... : Japanese levels of proficiency or experience LAN : Local Area Network NASDAQ : National Association of Securities Dealers Automated Quotation System NASSCOM : National Association of Software ... historical legacy that has created a greater awareness of French and English than many East Asian rivals Young Vietnamese with better English communication have already overcome the language barrier...

Ngày tải lên: 27/10/2012, 16:41

79 613 6
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

... respectful attitudes of Paley and Alvarez towards the value of life are always appreciated, especially in the contemporary age of technology, diseases and social evils, which has caused escalating ... mother had done was apparently a revenge against her and her husband for they had not been able to save their four and a half month baby from infant death For the past few years, Mabel had always ... indicate rather extreme casualty for the purpose of the author to draw a picture of a real awkward salesman, more or less reveal the informality of the American as the guests For an American,...

Ngày tải lên: 07/11/2012, 15:01

49 785 1
Cách sử dụng (Something) is down to (a number of something) pdf

Cách sử dụng (Something) is down to (a number of something) pdf

... to half a bag of rice” = “chúng n a bao gạo” Thông thường bạn nói số lượng vật/ đồ vật bị giảm, bạn liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tôi, Claire Maria Lưu ý sử ... thao “They’re down to teams now” = “giờ có đội” Hoặc nói việc bạn không sở hữu đồ vật mình: We sold the van, so we’re down to two vehicles now - bán xe tải, xe Hoặc đồ ăn: “We’re down to half a ... Với viết Daily English Speaking Lesson này, cho hiểu ro cách sử dụng " is down to " giao tiếp thường ngày Hãy xem thực hành cho ! “We’re down to only people now.” Công ty bạn v a gặp phải chút...

Ngày tải lên: 10/03/2014, 11:20

6 702 2
Providing detailed guidelines for implementation of a number of articles of the law on enterprise

Providing detailed guidelines for implementation of a number of articles of the law on enterprise

... of the converted company in the case of a limited liability company; number of shares and value of shares already sold, and number of shares carrying the right to offer for sale in the case of ... the case of a limited liability company; the chairman of the board of management and the director (general director) in the case of a shareholding company; all partners in the case of a partnership; ... individuals), names and head office addresses (in the case of legal entities), number of ordinary shares and ownership ratio, and date and number of registration as shareholder in the register of shareholders;...

Ngày tải lên: 27/03/2014, 10:15

28 631 0
My hobbiesI have a number of things pptx

My hobbiesI have a number of things pptx

... the stamps from discard envelope that my relatives and friends give me Mostly I get local stamps Once in while I get stamps from places like Sweden,Australia,Saudi Arabia and others I keep the ... should be able to it He is very good at accompanying himself and I admire him very much Another hobby that I spend time on is keeping tropical fishes I have a modest little glass aquarium where ... can play a few simple tunes I have even begun to sing while playing the guitar but I has not been too successful at this My uncle tells me that all I need is a lot of practice and I should...

Ngày tải lên: 22/07/2014, 03:21

5 501 1
Ôn thi TN 2011 - Chủ đề : many, much, a few, few, a little, little , most, most of, a number of, a great deal of…. pps

Ôn thi TN 2011 - Chủ đề : many, much, a few, few, a little, little , most, most of, a number of, a great deal of…. pps

... childhood A a large number of B a great deal of C a few D many 28) Peter has spent time and money on stamp collecting A a few of B many of C a great deal of D a large number of 29) I have got ... 37) Thank you very for your help A many B much C a lot of D little 38) He is very rich He has money in the bank A a great deal of B many C a large number of D few 39) She put too sugar ... coffee It became so sweet that I couldn’t drink it A many B much C few D little 40) I have got homework to A many B few C a lot of D a large number of 41) She has talked too A much B many...

Ngày tải lên: 28/07/2014, 07:21

3 678 3
Báo cáo y học: "Recently published papers: A number of treatment controversies" pptx

Báo cáo y học: "Recently published papers: A number of treatment controversies" pptx

... older, with an increased incidence of cardiovascular and respiratory failure, although there was no statistically significant difference in mean Acute Physiology and Chronic Health Evaluation III ... JL, Baron JF, Reinhart K, Gattinoni L, Thijs L, Webb A, Meier-Hellmann A, Nollet G, Peres-Bota D; ABC (Anemia and Blood Transfusion in Critical Care) Investigators: Anaemia and blood transfusion ... contained a significantly increased number of transfusion-independent patients, as well as a reduction in cumulative number of RBC units transfused when compared with placebo patients (a reduction of...

Ngày tải lên: 12/08/2014, 19:22

3 243 0
INVESTIGATION ON CLINICAL FEATURES, BRAIN IMAGING, a NUMBER OF RIKS FACTORS AND THE VALUE OF d DIMER IN DIAGNOSIS OF CEREBRAL VENOUS THROMBOSIS

INVESTIGATION ON CLINICAL FEATURES, BRAIN IMAGING, a NUMBER OF RIKS FACTORS AND THE VALUE OF d DIMER IN DIAGNOSIS OF CEREBRAL VENOUS THROMBOSIS

... diagnosis of CVT which is considered as a gold standard and can replace invasive conventional cerebral angiography and is used as a leading mean of diagnosis in case with clinical suspicion of ... percent of patients related to administration of oral contraceptive drugs was 13.8%, percent of abortions was 10.3%, no case was recognized as relating to pregnancy and hormone replacement therapy According ... 44%, subacute onset was 35% and chronic onset was 21% In general, the onset characteristics of CVT are varied, but the majority of patients have cubacute onset and our study data was equivalent...

Ngày tải lên: 21/10/2014, 21:52

28 327 0
A number of tongue twisters to practice the sounds in English to improve the consonantal pronunciation

A number of tongue twisters to practice the sounds in English to improve the consonantal pronunciation

... Rustle of trees and ripple of rain, roaring of rivers across the plain • Richard gave Robin a rap in the ribs for roasting his rabbit so rare • Strawberries, raspberries and redcurrants with real ... joined jealous Jenny Jerry making apple-jelly • Jane and Jenny in their blue jackets are watching the jaguar in the cage • It was a joy for Jack and George, the German boys, to cross the large bridge ... at the doors, Round the roofs and round the roads the rude wind roars, Raging through the darkness, raving through the trees, Racing off again across the great, grey seas Tongue twisters - The...

Ngày tải lên: 17/03/2015, 10:05

4 468 1
A study of advanced control charts for complex time between events data

A study of advanced control charts for complex time between events data

... bivariate exponential MEWMARaw MEWMA chart based on the raw GBE data MEWMATrans MEWMA chart based on the transformed GBE data r Smoothing factor of the MEWMA charts h Control limits of the MEWMA ... such as Ngai and Zhang (2001), Chan and Zhang (2001), Qiu and Hawkins (2001, 2003) Runger and Testik (2004) provided a comparison of the advantages and disadvantages of MCUSUM schemes, as well as ... , ) after the Box-Cox transformation with shape r r r r  parameter , scale parameter and location parameter The mean and standard r r r deviation of the transformed Weibull data are as follows:...

Ngày tải lên: 09/09/2015, 18:58

185 189 0
Phân biệt the number of  a number of

Phân biệt the number of a number of

... programs aboard by 2007 students who knew the answer of the test is very small crows are eating the grass applicants had been interviewed students absent from the class is Key: The number ... decrease, fall, rise…(trừ V ngoại động từ câu theo ngh a Con người tăng/giảm việc làm đó) C- Thực hành nhé! Điền “The number of hay A number of students had participated in intensive language ... The number of: 2, 5; A number of: 1, 3, Giải thích chi tiết: Các bạn nên nhớ The number of + N số Câu 1: thấy V participated- Tham dự  Chỉ có người tham dự số không tham dự  A number of Câu 2:...

Ngày tải lên: 22/07/2016, 08:52

2 564 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...

Ngày tải lên: 26/10/2012, 10:04

7 612 1
A study of linguistic features of real estate advertisements in english versus vietnamese

A study of linguistic features of real estate advertisements in english versus vietnamese

... What are the semantic and syntactic features of real estate advertisements in English? What are the semantic and syntactic features of real estate advertisements in Vietnamese? semantic features ... relax and entertain We start a day with it and we Language is a medium of thought, of communication and a also end a day with it In other word, real estate is a basic need for the means of the ... at least a sentence or a property (for sale by owner) In most situations in the United States, phrase acting as a slogan to attract readers A real estate real estate is a legal designation, and...

Ngày tải lên: 26/11/2013, 13:23

13 683 0
A discourse analysis of advertisements in english and vietnamese on the internet

A discourse analysis of advertisements in english and vietnamese on the internet

... Island Association The long Island Association Advocacy Networking Benefits LIA Long Island Association Leading long island Learn more In (52) “LIA” was illustrated by The long Island Association ... design was based on the combination of both descriptive and explorative approaches A contrastive analysis was conducted with English as L2 and Vietnamese as L1 3.2 DATA COLLECTION 3.2.1 Sampling After ... tình qua hotline”… functions This is because an educational message may be addressed to a receiver and it is associated almost with the addresser, and generally entails an attenuation of the...

Ngày tải lên: 26/11/2013, 13:29

15 2,3K 3
A discourse analysis of advertisements in terms of persuasion strategies in english and vietnamese

A discourse analysis of advertisements in terms of persuasion strategies in english and vietnamese

... learners in advertisements in terms of lexical choice, syntax and pragmatics in particular Therefore, A discourse analysis of advertisements in English and Vietnamese? terms of persuasion strategies ... persuasion – Alpha strategies and Omega strategies Then, the distinctive features of English and Vietnamese advertisements were found and analyzed 3.4 DATA COLLECTION The collected data for analysis ... describe and analyze then makes comparison and draws conclusions in order to reach the goals already set 3.1.2 Research Methodology approach forces An offer or a message can be made more attractive The...

Ngày tải lên: 26/11/2013, 13:29

13 1,1K 2
Tài liệu Bank Credit - A Study of the Principles and Factors Underlying Advances Made by Banks to Borrowers docx

Tài liệu Bank Credit - A Study of the Principles and Factors Underlying Advances Made by Banks to Borrowers docx

... 5199) of the National Bank Act: The directors of any association may, semi-annually, declare a dividend of so much of the net profits of the association as they shall judge expedient but each association ... days later, makes no essential difference; bank credit may take even the form of an overdraft The Bank Acceptance as Bank Credit The bank acceptance, which is a draft or bill drawn upon and accepted ... interest Cash is increased $500 and a new item, certificates of deposit, for the same amount, appears among the liabilities THE NATURE OF COMMERCIAL BANKING 19 A local patron of a Chicago mail order...

Ngày tải lên: 15/02/2014, 01:20

383 821 0
w