... following additional data are available with this paper online Additional data file contains additional figures Additional data file contains additional tables Additional data file contains the legends ... Additional data file (Table S30) In the ChromaTOF software the S/N threshold was set at 10, baseline offset at 1.0, data points for averaging at 7, and peak width at 2.5 The TOF mass spectrometer can ... 0.2/hour, and as these data had been normalized and statistically analyzed in the same way, we were able to make a realistic determination of the congruence between the level of any gene transcript and...
Ngày tải lên: 06/08/2014, 18:21
... the analysis and control of induction motor ASDs The space vectors are obtained by an invertible, static, abc^dq, transformation of phase variables The vector notation is used in dynamic equations ... phasor (or 1.5 times greater than that of the peakvalue phasor), while the phase angle is the same for both quantities • 6.2 DYNAMIC EQUATIONS OF THE INDUCTION MOTOR The dynamic T-model of the ... 737.4 A = 83.8 Z-26.5° A Thus, recalling that in the steady state the space vectors rotate in the stator reference frame with the angular velocity (o^ equal ca, the time variations of the stator...
Ngày tải lên: 28/12/2015, 17:00
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx
... FEMA Federal Emergency Management Agency INEEL Idaho National Engineering and Environmental Laboratory NASA National Aeronautics and Space Administration NIST National Institute of Standards and ... National Oceanic and Atmospheric Administration (NOAA), the DOE, the National Institute of Standards and Technology, and several universities to gather wind data, measure structural loading, and ... currently available for wind engineering research, advances are being made in a number of areas, such as the characterization of wind fields and the evaluation of the performance of the building...
Ngày tải lên: 08/03/2014, 19:20
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin ... (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin ... rate of interaction with factor Xa brought about by the heparin pentasaccharide-mediated conformational change occurs through a combination of the changes in the structure of the RCL, allowing the...
Ngày tải lên: 20/02/2014, 02:21
Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx
... dynein light chain P Rapali et al 88 Haraguchi K, Satoh K, Yanai H, Hamada F, Kawabuchi M & Akiyama T (2000) The hDLG-associated protein DAP interacts with dynein light chain and neuronal nitric oxide ... Fimia GM, Stoykova A, Romagnoli A, Giunta L, Di Bartolomeo S, Nardacci R, Corazzari M, Fuoco C, Ucar A, Schwartz P et al (2007) Ambra1 regulates autophagy and development of the nervous system Nature ... 2011 The Authors Journal compilation ª 2011 FEBS Organism Adenovirus Human, rat Human ASF virus Rat Human Human Human Fruit fly Mouse Rat Human Fruit fly Human Rat Human, rat Human Papilloma virus...
Ngày tải lên: 14/03/2014, 22:20
cottey a., edmunds t., forster a. femocratic control of the military in postcommunist europe. guarding the guards. 2002
... about the management and control of the armed forces As Andrew A Michta has argued, the Parys affair made it clear that the struggle for control over the armed forces was an important and ongoing ... Russia, Ukraine and the FRY, control of these non-regular armed forces is arguably as great a challenge for democratization as control of the regular military Conceptualizing democratic control of ... approval of senior military and politicalmilitary appointments (such as the Minister of Defence and the Chief of the General Staff); approval of declarations of war or states of emergency, of the...
Ngày tải lên: 04/06/2014, 00:37
Báo cáo y học: " Corticomotor control of the genioglossus in awake OSAS patients: a transcranial magnetic stimulation study" pdf
... data collection and interpretation All authors participated in and helped to draft the manuscript All authors read and approved the final manuscript Additional material 10 Additional file Table ... behavior of the UA dilator muscles in OSAS patients For instance, an OSAS-related increase in the tidal phasic activity of these muscles has been interpreted as compensatory of smaller pharyngeal ... patients, that cortical arousal is often required to increase UA muscles activity in OSAS [13] and also that the net activity of the upper airway dilators is higher in awake OSAS patients than...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc
... Yanagihara Y, Mao XQ, Gao PS, Arinobu Y, Ihara K, Takabayashi A, Hara T, Enomoto T, Sasaki S, Kawai M, Hamasaki N, Shirakawa T, Hopkin JM, Izuhara K: Cutting edge: dominant effect of Ile50Val ... this was a cross-sectional study in which participants had radiographs performed after various durations of RA Severity was not calculated on the basis of the rate of accumulation of joint damage ... Statistical analysis The data were analyzed with GraphPad Prism version 4.02 software (GraphPad Software Inc., San Diego, CA, USA) Paired comparisons were performed using a twotailed t -test Values...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: " Reflex control of the spine and posture: a review of the literature from a chiropractic perspective" potx
... putative postural reflex function(s) A theoretical example may be a thoracolumbar pain caused by a swayback posture It is postulated that the swayback posture may be the result of a forward head ... information regarding eye alignment and stabilization [44] This is an important part of the visual postural control pathway, as this pathway may compensate for visual deprivation such as in darkness ... detects head rotation through the semicircular canals, 2) the translational vestibulo-ocular reflex, which detects linear acceleration of the head via the utricle and saccule, and 3) the ocular counter-rolling...
Ngày tải lên: 13/08/2014, 13:22
A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY
... the structure of each part of the test, the type of materials with which the candidates will have to engage, the source of materials, the extent to which authentic materials may be altered, the ... illustrated in the following table: Type of test Proficiency test Characteristics Measure peoples abilities in a language regardless of any Diagnostic test training they may have had in that language ... the quality of a test The investigation and evaluation of the reliability of the final achievement computer-based MCQs test are therefore useful to the judgment of the quality of teaching, learning...
Ngày tải lên: 10/04/2013, 14:46
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
... canal and ponds It was partly because the people had considered the biogas plant as maintenance free and they did not any maintenance at all with lack of the appropriate technical knowledge Also, ... populated countries of the world, with a population of about 129 million in 2001(Bangladesh Bureau of Statistics, 2002) Dhaka is the capital city of Bangladesh, and Bauniabad is one of the urban ... and water quality analysis of the biogas plants were conducted BACKGROUND Study area Bangladesh lies in the northeastern part of South Asia, and has an area of 147,570 km2 It is one of the most...
Ngày tải lên: 05/09/2013, 09:08
BIOS Takes Control of the UHCI Host Controller
... registers and host controller communications area (HCCA) 5* Start sending Start of Frame (SOF) tokens on the USB This article examines the third step of the process—taking control of the host controller—in ... registers and host controller communications area (HCCA) 5* Start sending Start of Frame (SOF) tokens on the USB This article examines the third step of the process—taking control of the host controller—in ... How the Microsoft host controller driver uses the SOF MODIFY register When the Microsoft host controller driver takes control of the host controller from the BIOS, it always reads the value of the...
Ngày tải lên: 07/10/2013, 00:20
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... in the application and the written arguments presented in the appeal briefs After careful consideration of these materials, we hold that the refusal to register must be affirmed As applicant ... registration are unrelated to those listed in the application The Examining Attorney again found these arguments unpersuasive, and he issued an Office Action to that effect The Board instituted the ... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the written...
Ngày tải lên: 20/12/2013, 23:15
Direct torque control of brushless DC motor with non sinusoidal back EMF
... influence of the unexcited open-phase back-EMF causes each straight side of the ideal hexagonal shape of the stator flux linkage locus to be curved and the actual stator flux linkage trajectory ... phase back-EMF for smooth torque generation, there is no easy way to control the stator flux linkage amplitude On the other hand, rotational speed of the stator flux linkage can be easily controlled, ... linkage amplitude because it depends on the size of the sharp dips and the depth of the change may vary with sampling time, dc-link voltage, hysteresis bandwidth, motor parameters especially the...
Ngày tải lên: 03/01/2014, 19:44
Direct torque and indirect flux control of brushless DC motor with non sinusoidal back EMF without position sensor
... frame are not constant, therefore current wave shapes require very fast controllers in particular at high speed Classical bandwidth of the controller (such as proportional– integral) does not allow ... linkage trajectory is kept same, however its amplitude is smaller compared to the initial case which means that the flux in the machine is weakened to obtain maximum possible torque above the base ... is the sliding surfaces band In order to decrease the pure integrator influences in Back-EMF estimation in (7), the integral operator is replaced by a low pass filter Finally, the back-EMF sliding...
Ngày tải lên: 03/01/2014, 19:45
Direct torque and indirect flux control of brushless DC motor
... means that the actual value of the torque is above the reference and out of the hysteresis limit and τ = means that the actual value is below the reference and out of the hysteresis limit The same ... estimation algorithm is derived in dq frame consisting of actual dq-axes back EMF constants and currents Instead of the actual back EMF waveforms, Fourier approximation of the back EMFs could have ... line-to-line back EMF waveforms eba (θr e ) and eca (θr e ) are obtained of ine and converted to the ba–ca frame back EMF constants kba (θr e ) and kca (θr e ) The line-to-line Park transformation matrix...
Ngày tải lên: 03/01/2014, 19:46
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... calculation of k+ We have tested the application of the uorescent analogue CBC as a tool for investigation of the binding kinetics of nonuorescent ligands Cyano-cobalamin (CNCbl) was examined in the ... corresponds to change of absorbance at wavelength 352 nm in the reaction sample after incubation time t; DAmax ẳ jACNCbl AH2 OCbl j stands for maximal poss352 ible change in the amplitude at wavelength, ... transition in the absorbance spectra of the protein-associated ligands IFH2OCbl IFCNCbl As seen from the data in Fig 5C, stability of both IF30CblIF20 and IF30CBCIF20 was lower than that of the...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx
... GGTTGCCTGAGRTGYATHTGa GGGCTATTGGTCAGACGCTACACTC GAGTGTAGCGTCTGACCAATAGCC GATCTGATACGGTCCACACGACAG GCLRCIC GYWSDATL GYWSDATL LSCGPYQI H ¼ A or C or T; R ¼ A or G; Y ¼ C or T transcription The cDNA was ... the bivalve Tapes japonica [3], with the so-called chlamysin of Chlamys islandica [4,5], and also with a hypothetical secreted protein of the nematode Caenorhabditis elegans and with putative ... was treated with RNAase-free DNAase I (Pharmacia) for 30 at 37 °C cDNA was synthesized by reverse transcription from DNAase-treated RNA using Moloney murine leukaemia virus reverse transcriptase...
Ngày tải lên: 19/02/2014, 12:20
Research Program of the Partnership for a New Generation of Vehicles doc
... OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering ... Laboratory, Lawrence Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National ... technical area is a major collaborative effort of the individual partners, the national laboratories, and a few universities The Pacific Northwest National Laboratory, Lawrence Livermore National Laboratory,...
Ngày tải lên: 06/03/2014, 15:20
Apollonius of Tyana, the Philosopher-Reformer of the First Century A.D. potx
... Xerxes; they invaded Thessaly and fought at Plataea From the time of Alexander onwards there was direct and constant contact between [ =A] ry[ =a] varta and the kingdoms of the successors of the world-conqueror, ... was initiated four years later (iv 18; v 19) While at Athens Apollonius spoke strongly against the effeminacy of the Bacchanalia and the barbarities of the gladiatorial combats (iv 21, 22) The ... be a corruption of Arhat.[99] The main burden of Damis' narrative insists on the psychic and spiritual knowledge of the sages They know what takes place at a distance, they can tell the past and...
Ngày tải lên: 07/03/2014, 03:20