... years which I spent at Cambridge my time was wasted, as far as the academical studies were concerned, as completely as at Edinburgh and at school." "In order to pass the B .A. Examination, ... the translation of Prof. Strasburger's essay Madame Errera of Brussels rendered valuable help. Mr Wright, the Secretary of the Press Syndicate, and Mr Waller, the Assistant Secretary, have ... H.M.S. 'Adventure' and 'Beagle'" Publication of the "Zoology of the Voyage of H.M.S. 'Beagle'", Part II., "Mammalia", by G.R. Waterhouse,...
Ngày tải lên: 28/06/2014, 19:20
... a project manager can and must influence through- out the project trajectory. In contrast, Barki et al. observed risk dimensions that are beyond managers' operational control and which managers ... improve the manuscript and the analysis. We are also grateful to Esko Leskinen and Kari Heikkinen for their advice on statistical analyses. Thanks go also to Mark Keil and Lars Mathiassen for their ... Shaping and Software Risk A Categorical Analysis of Four Classical Approaches,º Information Systems Research, vol. 9, no. 3, pp. 233- 255, Sept. 1998. [35] J. March and Z. Shapira, êManagerial...
Ngày tải lên: 07/03/2014, 00:20
modeling of chemical kinetics and reactor design by a. kayode coker
... temperature. Table 2 shows the raw materials requirements, yield, and properties of ammonia. Transportation is by railroad tank vehicle, by tank truck, or by pipeline. In this case, transportation at ambient ... factors that deter- mines the storage method is the quantity of ammonia to be stored. Ammonia is toxic and flammable, although the lower flammable limit is quite high and fires in ammonia facilities ... both academic and industrial research organizations have enabled these groups to review the state of the art and cooperate with the overall objectives of improving the safety, yields, and quality...
Ngày tải lên: 01/04/2014, 10:25
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf
... 22:477-481. 32. Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody-forming cell responses in the nasal-associated lymphoid tissue of mice vaccinated by intranasal, intravenous and/ or subcuta- neous administration. ... T, Aizawa C, Nakagawa M, Kurata T: Functional role of respiratory tract haemagglutinin-specific IgA antibodies in protection against influenza. Vaccine 1990, 8:479-485. 31. Tamura SI, Asanuma ... Hori- zontal bars show GMTs within distinct immunization protocols. Data were ana- lyzed by ANOVA and Tukey's Multiple Comparison post test and marked as in A. Ab response and protection after various...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Bi-Functional Silica Nanoparticles Doped with Iron Oxide and CdTe Prepared by a Facile Method" doc
... Tianjin Shuangchuan Chemical Reagent Factory, China. TEOS was purchased from Tianjin Chemical Reagent Company, China. 3-aminopropyltrime- thoxysilane (APTMS) was commercially available from Fluka. Other ... spectra (FT-IR), and fluorescent microscopy. The characterization results showed that the final nanomaterial possessed a saturation magnetization of about 5.8 emu g -1 and an emission peak at 588 nm when ... brightness, narrow and size-tunable emission, fairly high quantum yields, and good chemical and photo stability. These properties make CdTe nanocrystals suitable for biological applications, fabricating...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo y học: " HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector" ppt
... reverse: 5'-cgccaacatagaccaccttttc) and CCR5 (forward: 5'-caaaaagaaggtcttcattacacc and reverse: 5'-cttgctcgctcgggagcctc) (IDT, Coralsville, IA) were used to determine transcript ... (Promega), was used to visualize the bands. RT-PCR Total RNA was extracted from non-transduced and trans- duced cells. Primers specific for CXCR4 (forward: 5'-ggag- gggatcagtatatacacttc and ... actin as an internal control. A secondary antibody, goat anti- rabbit IgG conjugated with alkaline phophatase (Promega, Madison, WI), was then added. An alkaline phophatase substrate reagent, Western...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Objective Structured Clinical Examinations (OSCEs), psychiatry and the Clinical assessment of Skills and Competencies (CASC)Same Evidence, Different Judgement" ppsx
... long cases with each long case involving a partly observed interview of a real patient. Part II also involved an oral examination involving some standardized patient man- agement problems. Authors ... difficulty and features of a patient [34]. Testing context can significantly predict performance in an OSCE [35]. Therefore focussing a candidate on a particular area at a CASC station may in itself ... checklists and global rating scales for assessing performance on an OSCE-format examination. Academic Medicine 1998, 73:993-7. 20. Carraccio C, Englander R: The objective structured clinical examination:...
Ngày tải lên: 11/08/2014, 15:22
slike bài giảng ứng dụng xây dựng hệ thống thông tin chương 3 the analyst as a project manager
Ngày tải lên: 24/10/2014, 15:36
Charles Frohman: Manager and Man, by Isaac1Charles Frohman: Manager and Man, by IsaacThe Project Gutenberg eBook, Charles Frohman: Manager and Man, by Isaac Frederick Marcosson and Daniel Frohman, et al This eBook is for the use of anyone anywhere at pot
... (http://www.gutenberg.net/dirs/2/6/1/4/26146/26146-h.zip) CHARLES FROHMAN: MANAGER AND MAN by ISAAC F. MARCOSSON and DANIEL FROHMAN With an Appreciation by James M. Barrie Illustrated with Portraits New York and London Harper & Brothers ... FITCH HENRY ARTHUR JONES W. LESTOCQ CHARLES DILLINGHAM MAUDE ADAMS MAUDE ADAMS FRANCIS WILSON WILLIAM COLLIER MARGARET ANGLIN Charles Frohman: Manager and Man, by Isaac 3 Thus it came about that for ... became treasurer of the company. Alf Hayman, whom Frohman had met in Philadelphia, was engaged as advance-agent. It was a courageous undertaking even for a seasoned and well-financed theatrical...
Ngày tải lên: 23/03/2014, 05:20
A handbook for project managers, developers, implementers, evaluators and donors working to counter trafficking in persons. ppt
... approximately 100 victims of tracking in Africa, Asia (excluding Australia, Japan and New Zealand), Latin America and the Caribbean who are unable to access adequate support through any other ... El-Dardiry, Christophe Franzetti, Lidia Futter, Harvy Gadia, Ashley Garrett, Tatiana Ivanyuk, Frank Laczko, Fred Larsson, Par Liljert, Amy Mahoney, Agueda Marin, Jonathan Martens, Ruzayda Martens, ... that it is treated with the utmost care and condentiality. All disclosures of personal data both within and outside an organization should be carefully evaluated on a case by case basis. Data...
Ngày tải lên: 30/03/2014, 01:20
Research and Writing Skills Success in 20 mins a day
... that analyzes a particular topic or book, while a research paper involves analyzing raw data and different facts and statistics from a variety of sources. Once you have collected all your materi- al, ... materi- al, you will learn how to use it as the basis for a persuasive argument. You will also learn how to: ■ Arrange and organize all your data and information in a logical sequence. ■ Prepare ... is helpful and handy because a. note cards can be arranged easily and quickly and stored in one place. b. note cards are a more respected way of taking down information. c. note cards look more...
Ngày tải lên: 18/03/2013, 01:45
DMF Decomposition and Nitrogen Removal Performance by a Mesh-Filtration Bioreactor under Acidic Conditions
Ngày tải lên: 05/09/2013, 09:38
Ecological Assessment of Water Quality by Three-species Acute Toxicity Test and GC/MS Analysis - A Case Study of Agricultural Drains
Ngày tải lên: 05/09/2013, 10:15
a discourse analysis of opening and closing speeches by masters of ceremonyon reality television showsin american english versus vietnames
Ngày tải lên: 26/11/2013, 12:41
Tài liệu Creating a Logical Standby Database by Using Enterprise Manager ppt
... Logical Standby Database with Enterprise Manager Click “Add Standby Database.” 7 Copyright â 2006, Oracle. All rights reserved. Creating a Logical Standby Database by Using Enterprise Manager ... the database. – STANDBY: prevents users from making changes to any data maintained by Data Guard SQL Apply. NONE: normal security ã Query GUARD_STATUS column in V$DATABASE. ã Database guard level ... Logical Standby Database ã Configure the database guard to control user access to tables. ã ALTER DATABASE GUARD command keywords: ALL: prevents users from making changes to any data in the database. – STANDBY:...
Ngày tải lên: 09/12/2013, 16:15