singular homology of a starshaped region in rⁿ

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

... feto-acinar pancreatic protein (FAPP), has been detected in human embryonic and fetal pancreas and in pancreatic tumoral cell lines [35,36] FAPP and BSSL are structurally closely related, but are ... signals were visualized using Molecular Imager (Bio-Rad) 32 P-Labelled k HindIII DNA was run in parallel as a size marker Cloning and DNA sequencing The region of repeats in BSSL exon 11 was PCR ... number of repeats are fewer compared to BSSL Naturally occurring variants of BSSL, differing in apparent molecular mass, have been described in human milk [27±29] Variants of higher, as well as lower,...

Ngày tải lên: 24/03/2014, 03:21

9 521 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt

Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt

... Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the impacts of potential climatic ... leaf area is terminated by the autumn phenological stage (autumn yellowing of leaves) According to budbreak 10% beginning of foliage formation 10% beginning of foliage formation 50% beginning of ... 150 100 50 Year average annual air temperature air temperature in the growing season annual precipitation percipitation Fig 10 Average annual air temperatures and annual precipitation in 1990–2007...

Ngày tải lên: 07/08/2014, 03:22

12 386 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... parameters defined in Tables and in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy project located ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attractiveness Table Economic and financial indicators...

Ngày tải lên: 05/09/2013, 14:59

14 416 1
Sensor-based navigation of a mobile robot in an indoor environment

Sensor-based navigation of a mobile robot in an indoor environment

... obtained after including the unknown obstacle in the data base and starting again the planning [15] In fact the main penalization due to unknown obstacles is the decreasing of the linear speed of ... We are interested in the navigation of a mobile robot in partially known environment such as inside an of ce or a flat In such cases, a plan of the evolution zone of the robot containing most of ... the beginning of the learning the robot is near a wall in an unknown Vr = min(Va , Cvg Vmin ), where Vmax and Vmin are the maximum and minimum chosen linear speed, respectively An example of implementation...

Ngày tải lên: 23/10/2013, 15:15

18 432 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the above interpretation was further reinforced...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

... transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial strains and plasmids ... immunoprecipitated with antiserum directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig 4B, lane 1) In addition, cross-linking adducts of  220 kDa and ... immunoprecipitated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager (B) Quantification of data presented in panel (A) , after correction for translation...

Ngày tải lên: 08/03/2014, 09:20

8 547 0
The Project Gutenberg EBook of A First Book in Algebra, pot

The Project Gutenberg EBook of A First Book in Algebra, pot

... subtracted from − 4a to obtain a? (− 4a) − (− 3a) =? Examine now these results expressed in another form 33 From take 5a 3a 2a To add 5a − 3a 2a From take 4a 7a − 3a To add 4a − 7a − 3a From take 2a 5a ... 2ax2 + ax + 2a 17 A man pumps x gallons of water into a tank each day, and draws off y gallons each day How much water will remain in the tank at the end of five days? 18 Two men are 150 miles apart, ... 2a, 3a, 4a, 5a What must be added to 2a to obtain 5a? What then must be subtracted from 5a to obtain 2a? 5a − 3a =? What must be added to − 3a to obtain 4a? What then must be subtracted from 4a to...

Ngày tải lên: 15/03/2014, 00:20

189 432 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra ... the following oligonucleotide primers: 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast expression ... thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were in ltrated into the same leaves of tobacco plants, which had been sprayed with 100 lm ABA, 400 lm ABA or H2O and kept in...

Ngày tải lên: 15/03/2014, 00:20

15 479 0
Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt

Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt

... replacement of a Pro with an Ala maintained or decreased the antimicrobial activity but significantly increased the hemolytic activity In addition, Oh et al [38] reported that a cecropin A magainin ... antimicrobial activity The antimicrobial activity of peptides against a range of micro-organisms was determined by broth microdilution assay Briefly, a single colony of bacteria was inoculated into ... other Central proline in amphipathic a- helix amphipathic a- helical peptides such as magainin [52,53], the initial binding of M17P (K1 ¼ 6.8 · 104 m)1) was much faster than the following insertion...

Ngày tải lên: 23/03/2014, 10:21

15 376 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A 78 A1 K UG a ... UG na B C1 thalia T89 UG 9B1 A UGT8 9A1 P A thaliana M T7 UG 0.1 UGT8 a lian tha C UGT9 2A1 A thaliana A rum rba ba UGT90 A1 A th aliana UGT 73D1 A tha UG liana T 0L na lia A t D 73C 1 3B 3A T7...

Ngày tải lên: 28/03/2014, 23:20

11 661 0
Báo cáo khoa học: Functional role of the linker region in purified human P-glycoprotein pot

Báo cáo khoa học: Functional role of the linker region in purified human P-glycoprotein pot

... cleavage generated a 56 kDa fragment As P-gp cleavage proceeded, the verapamil-stimulated ATPase activity gradually increased to a maximum of 340% within 105 The increase in verapamil-stimulated ... protease digestion was set to a value of 100% The remaining amounts of native P-gp (%) were quantied using IMAGE J software (National Institutes of Health) In ATPase activity measurement, all data ... a cleavage activation site, as described previously [21] However, increased ATPase activity also indicates that the linker region has another role as a suppressor of ATPase activity in the native...

Ngày tải lên: 29/03/2014, 23:20

13 313 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada) ... from the National Science and Engineering Research Council of Canada S Seah thanks the Canadian Foundation for Innovation and Ontario Innovation Trust for infrastructure support We thank Valerie ... metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization of the anion...

Ngày tải lên: 30/03/2014, 15:20

9 461 0
báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

... development of the computer program which had to include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... feedback of HRQoL has as of yet not been widely implemented in clinical practice This may be explained by the initial lack of convincing data regarding the effectiveness of standardized HRQoL measurement...

Ngày tải lên: 18/06/2014, 19:20

9 477 0
báo cáo hóa học: " A randomized trial of a lifestyle intervention in obese endometrial cancer survivors: quality of life outcomes and mediators of behavior change" pptx

báo cáo hóa học: " A randomized trial of a lifestyle intervention in obese endometrial cancer survivors: quality of life outcomes and mediators of behavior change" pptx

... demographic and clinical data was obtained at baseline and prior to randomization QOL and self-efficacy were assessed at baseline and at 3, 6, and 12 months Eating behavior and depression was assessed ... measures analysis of variance (ANOVA) with the 3, and 12 month data as outcomes and the appropriate baseline measurement as a covariate to test for the main effect of group (LI versus UC, intention-to-treat ... indicating an increase likelihood to overeat in the presence of disinhibitors This was an unexpected finding and may indicate that there are still certain triggers that are evident and more attention...

Ngày tải lên: 18/06/2014, 19:20

9 444 0
Báo cáo sinh học: " Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene" potx

Báo cáo sinh học: " Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene" potx

... GGGACAAGTG AAAATGTCTC TTCAGGGGAT TCAGCTTAGT GACTTGTCCT ATAAGCATGC AATCCTTAAA GAATCACAGT ACACAATCAA GGGACAAGTC AAAATGTCTC TTGAAAGTAT TAGACTCAGT GACTTGGAGT ACAAACATGC AATTCTTGAA GACTCTCAGT ATACAATTAG 90 ... aMPV /A/ UK/3b AGGTAGTGAG GTGCAGGCAG TATTGACCAA GACA TACT CTCTTGG-GA AGGGCAAAAA CAGCAAAGGG GAGGAGTTGC AAATGTTAGA CGGTAGTGAA GTACAGGGTG TTATGACCAA GATTGTTACA CTTTCGGCAG AGGGTTCTGT CAGAAAGCGA GAGGTGCT AAACATTCAC ... CAATGGGAGC AATGG TTA GGGAAAAAGT GCAACTCA 444 443 aMPV/C/US/Co aMPV /A/ UK/3b ACCAATACCA CAAAATCAAA GACCATCATC CCCGGATGCT CCTATCATAC TACTCTGCAT AGGAGCATTA ATCTTCACGA AGCTGGCATC CAA - -AGAATCAAA...

Ngày tải lên: 19/06/2014, 08:20

9 438 0
báo cáo hóa học:" Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene" potx

báo cáo hóa học:" Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene" potx

... GGGACAAGTG AAAATGTCTC TTCAGGGGAT TCAGCTTAGT GACTTGTCCT ATAAGCATGC AATCCTTAAA GAATCACAGT ACACAATCAA GGGACAAGTC AAAATGTCTC TTGAAAGTAT TAGACTCAGT GACTTGGAGT ACAAACATGC AATTCTTGAA GACTCTCAGT ATACAATTAG 90 ... aMPV /A/ UK/3b AGGTAGTGAG GTGCAGGCAG TATTGACCAA GACA TACT CTCTTGG-GA AGGGCAAAAA CAGCAAAGGG GAGGAGTTGC AAATGTTAGA CGGTAGTGAA GTACAGGGTG TTATGACCAA GATTGTTACA CTTTCGGCAG AGGGTTCTGT CAGAAAGCGA GAGGTGCT AAACATTCAC ... CAATGGGAGC AATGG TTA GGGAAAAAGT GCAACTCA 444 443 aMPV/C/US/Co aMPV /A/ UK/3b ACCAATACCA CAAAATCAAA GACCATCATC CCCGGATGCT CCTATCATAC TACTCTGCAT AGGAGCATTA ATCTTCACGA AGCTGGCATC CAA - -AGAATCAAA...

Ngày tải lên: 20/06/2014, 04:20

9 437 0
báo cáo hóa học:" Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" pptx

báo cáo hóa học:" Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" pptx

... development of the computer program which had to include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... feedback of HRQoL has as of yet not been widely implemented in clinical practice This may be explained by the initial lack of convincing data regarding the effectiveness of standardized HRQoL measurement...

Ngày tải lên: 20/06/2014, 16:20

9 370 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

... C*-ternary rings Taiwan J Math 13, 1985–1999 (2009) 11 Saadati, R, Vaezpour, M, Cho, Y: A note to paper “On the stability of cubic mappings and quartic mappings in random normed spaces” J Inequal Appl ... and Y a complete non-Archimedean normed space Assume that |m| ≠1 Lemma 3.1 Let X and Y be linear normed spaces and f : X ® Y a mapping satisfying (1) Then f is an additive mapping Proof Letting ... Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 184, 431–436 (1994) doi:10.1006/jmaa.1994.1211 Skof, F: Local properties and approximation of operators Rend Sem Mat Fis Milano...

Ngày tải lên: 20/06/2014, 22:20

14 480 0
w