... +PIS and –PIS strains, a release of label in the aqueous phase was observed after incubation To calculate the liberation of radioactivity due to a putative reverse reaction, the amount of label ... using an apparent EDTA stability constant K1 of · 1011ÆM)1 for manganese at pH 8.0 [18] At 7.5 mM EDTA, when the calculated concentration of free manganese ions is in the submicromolar range, a synthesis ... counterbalanced by an equivalent disappearance of PtdIns in the lower phase ()108 pmolÆmin)1Æmg)1) On the other hand, membranes lacking AtPIS1 not induce any variation in the radioactivity partitioned...
Ngày tải lên: 22/02/2014, 04:20
... epimerase Durations of initial lag of catalysis are indicated by vertical dotted lines The parallel nature of curves and indicate that, at steady state, the catalytic efficiencies of the two forms of ... namely inactivation and formation of NADH (Fig 2B) The last two parameters are sensitive enough to be measured with an accuracy of ± 0.25% The dependency of the lag in catalysis followed a sharp ... Regulation of catalytic sites of yeast epimerase away from the subunit contact region, and its monomers are functional [9] The molecular mass of the yeast enzyme is almost double that of the bacterial...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: Solution structure and stability of the full-length excisionase from bacteriophage HK022 pot
... partial molar heat capacity (solid line) and the best-fit partial molar heat capacity (dots) of HK022 Xis_wt The partial molar heat capacities of the Xis_wt native (CN) and denatured (C D ) states ... (Tm) was so low, and consequently the denaturation enthalpy (DH) so small, that the molar partial heat capacity function [Cp,pr(T)] did not contain a substantial peak Although the Cp,pr(T) of the ... purification of the Xis_wt and Xis_C28S proteins The isolation and purification of Xis was hampered by the fact that the protein can adopt a non-native conformation, characterized by a significant decrease...
Ngày tải lên: 23/03/2014, 15:21
– ANSWERS – Set 26 (Page 66) 390. a. Since one-half of the four children are girls, two must potx
... two largest theaters Also, the theater never shows a foreign film in the largest theater Theaters and must show the movies that are rated G and PG, so the movies that are there must stay there The ... states that threading a needle involves motor skill The other choices are not in the paragraph 477 a The paragraph states that Mars once had a thick atmosphere, but that it was stripped away The ... figure of million The paragraph states that the record of 4.75 million was at an annual, not a monthly, rate 460.b The last sentence in the paragraph clearly gives support for the idea that the...
Ngày tải lên: 18/06/2014, 17:20
FROM THE AUTHOR OF THE BEST-SELLINGWORDS ARE CATEGORICAL ppt
... headlines and you’ll come to the grams department a full selection of pangrams, anagrams, and even word diagrams And the best news of all is that THE LAUGH STAND comes with a guarantee—to make ... in the following sentences are anagrams of other words in the same sentence: PANS always SNAP my dad’s N A P S As R H E A ’ S preparing to S H E A R , she H E A R S the H A R E S as they S H A ... clowns), all you have to is add an “s” on the end of the word and you make it plural There are exceptions, however These are called irregular plurals because adding an “s” doesn’t make them plural,...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx
... Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R Murty, Graph Theory ... the size of graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou Teachers ... vertices, and (G) denote the number of edges In this paper, we construct a graph G having no two cycles with the same length which leads to the following result Theorem Let t = 27720r + 169 (r ≥ 1), then...
Ngày tải lên: 07/08/2014, 06:22
Báo cáo toán học: "Zeros of the Jones polynomial are dense in the complex plane" pdf
... applying BerahaKahane-Weiss’s Theorem and Sokal’s lemma, we prove that zeros of the Jones polynomial of pretzel knots are dense in the complex plane the electronic journal of combinatorics 17 ... Let Ha be the graph obtained from Ha by identifying u and w, the two attached vertices of Ha Let ′ (dQ[Ha ] − Q[Ha ]), −1 ′ a = β[Ha ] = (dQ[Ha ] − Q[Ha ]), d −1 α[Ha ] a = γ[Ha ] = + d β[Ha ... dq(G a) +1−p(G a) +1 dq(G /a) +1−p(G /a) −1+1 a Q[G − a] + a Q[G /a] a b∈E(G a) βb a b∈E(G a) βb a = d T [G − a] + T [G /a] (19) a = the electronic journal of combinatorics 17 (2010), #R94 Comparing...
Ngày tải lên: 08/08/2014, 12:22
Báo cáo y học: "Revisiting Lynam’s notion of the “fledgling psychopath": are HIA-CP children truly psychopathic-like" ppsx
... psychopath,” we compared the four groups on parental ratings of child psychopathic personality traits (APSD) As Table displays, planned contrasts revealed that the HIA-CP group appeared the most ... Participants The present study was a part of a larger investigation of social-cognitive and emotional correlates of antisocial behavior in a large community sample of children (the Child Behavior ... in any way gain or lose financially from the publication of this manuscript, either now or in the future Neither of the authors holds any stocks or shares in an organization that may in any way...
Ngày tải lên: 13/08/2014, 18:21
Give correct forms of the verbs
... accident on the Main Road yesterday A boy (knock) down by a car Then he (take) to the nearest hospital 47 Most of the Earth’s surface (cover) by water 48 The first festival (hold) nearly eight ... hit me in the back I (not know) what it was 72 When I (see) the man, he (stand) outside the bank He (have )a cap on 73 When I (open) the cupboard door, a pile of books (fall) out 74 I can’t help ... to go for a walk 69 I (lie) in the beach when the phone (ring) It (stop) after a few rings 70 It (be) cold when we (leave) the house that day, and a light snow (fall) 71 I (walk) along the street...
Ngày tải lên: 07/06/2013, 01:26
Tài liệu Supply the correct form of the verbs1 docx
... were a bird, I wouldn't want to live in a snake 14 My brother managed to kill the snake just at the time when I were almost exhausted If he had beena little late, I would have killed by the snake ... (not,want) wouldn't want to live in a snake 14 My brother managed to kill the snake just at the time when I (be) had been almost exhausted If he (be) had been a little late, I (kill) would have ... wet if she (wear) a raincoat.had worn If today (be) a holiday, I would stay in bed for all day long.were If she ( make) him change his mind, she would save him a lot of trouble.made I wish he...
Ngày tải lên: 23/01/2014, 07:20
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx
... resultant force is to be F1, directed along the keel aa as shown, determine the magnitudes of forces T and P acting in each rope and the angle θ of P so that the magnitude of P is a minimum T acts ... - Statics Chapter Problem 1-16 Two particles have masses m1 and m2, respectively If they are a distance d apart, determine the force of gravity acting between them Compare this result with the ... deg F A = F cos ( θ ) F A = 520 N F B = F sin ( θ ) F B = 300 N Problem 2-29 Three chains act on the bracket such that they create a resultant force having magnitude F R If two of the chains are...
Ngày tải lên: 17/02/2014, 14:20
Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc
... local Src activation triggered the long-range propagation of active Src wave into the distal cell areas away from the site of mechanical stimulation [50] The mechanism of this wave propagation is ... reactions (see, Table S1) and warrant a detailed exploration of Src responses under various conditions that encompass the vast parameter space Variation of the apparent first-order rate constants ... to have approximately similar catacat cat lytic activities [7,33], we assume that ka1 =Ka1 $ ka2 =Ka2 for illustrative purposes Notably, Src association with the plasma membrane can lead to a significant...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation of the ... pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA ATCTTCTC-3¢, corresponding to NTs )119 to )94) (7) Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC ... UK) as described by the manufacturer Statistical analysis Statistical analyses of differences were analyzed using the two-tailed Student’s unpaired t-test All values are expressed as mean ± standard...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... (position is the A of the first AUG) For TAP1 we used the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary ... of 2C1 appears to have lost the ability to exchange ADP for ATP The specificity of ADP-binding was tested by the addition of free MgADP All TAP chains showed a 40–50% release at mM MgADP (data ... 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased from ARK/Sigma The chimeric TAP construct 1V2 was created by ligation of the...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc
... similar to each other In particular, the parameters for VIHN complexes not deviate systematically from those of DAHam and DAHKam This means that the side chain carboxylate of Asp1 does not have a ... DAHKam is now much lower from those of albumins, and the reaction of DAHam is much faster The reaction rates for albumins and DAHam are higher from the value for pure acid GGH dissociation The ... of Cu(II) and Ni(II) transport by albumins On the other hand, the direct thermodynamic and kinetic characterization of Ni(II) binding at site I in HSA and BSA was obtained These data can be very...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu There are two benches to the left of the shop ppt
... be" chia dạng số “is, was…”; sau động từ "to be" danh từ số nhiều "to be" chia are, were…”) Ví dụ: There is a boy and two girls in the classroom There are two girls and a boy in the classroom ... từ đó) There are two benches to the left of the shop 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: There are two benches to the left of the shop 3 Tại câu lại dịch vậy? -“There are two ... *There are two benches to the left of the shop Hình thức ngữ pháp : cấu trúc: “there are/ is….to the left of ” – (có bên trái gì) Chúng ta quan sát câu sau Các bạn di chuột...
Ngày tải lên: 26/02/2014, 00:20
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... protein Although immunoblot analysis demonstrated that the single and double mutants had decreased mass compared with the wild-type protein, they still appeared to be of higher molecular mass than the ... of tunicamycin Drug treatments resulted in the accumulation of forms of the mutant proteins that were of lower apparent molecular mass and of similar size to the unglycosylated form of the wild-type ... N-Glycosylation of HFE TGGGCGTGATTTTCCAT To generate the pEP7–HFEN13 0A HA mutation we used the following primer set: sense, ATGCAAGAAGACGCCAGTACCGAGGGC; antisense, GCCCTCGGTACTGGCGTCTTCTTGCAT To generate...
Ngày tải lên: 06/03/2014, 22:21