... impart, by a variety of means, knowledge to their learners: the task-oriented side of teaching All in all, a teacher can be addressed as a manager, an instructor, a resource, a guide, an evaluator, ... foreign languages in general as well as attitudes towards the specific language community and integrative orientation to language study The second is attitudes towards the language situation as a whole, ... (Jeremy Harmer, 1991) The writer chooses to view the teacher as an informant, a facilitator, a monitor, an assessor, an organizer, a controller, a manager, who acts interchangeably within the classroom...
Ngày tải lên: 07/09/2013, 13:06
... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... she was afebrile There was slight tenderness in her right lower abdominal quadrant No guarding or rebound tenderness was noted, and no abdominal mass was palpable Laboratory findings were: quantitative ... intrauterine pregnancies but not ectopic pregnancies remains unknown Figure (A) Transvaginal ultrasound of the cornual pregnancy (B) Detailed clarification of the ultrasound in (A) Page of (page...
Ngày tải lên: 11/08/2014, 14:20
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx
... 38:175-184 Husain AK, Khandeparkar JM, Tendolkar AG, Magotra RA, Parulkar GB: Temporary intravascular shunts for peripheral vascular trauma J Postgrad Med 1992, 38(2):68-69 Sriussadaporn S, Pak-art R: ... behalf of the East of Scotland Vascular Network References Yagubyan M, Panneton JM: Axillary artery injury from humeral neck fracture: A rare but disabling traumatic event Vasc Endovascular Surgery ... SD, Rasmussen TE, Goff JM, Johnson CA, Galgon RE, Sarac TP, Rich NM: Contemporary management of wartime vascular trauma J Vasc Surg 2005, 41(4):638-644 Clouse WD, Rasmussen TE, Peck MA, Eliason...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: " Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of chickens" pot
... Journal et al; from: distributed under the article is available article References Alexander DJ: Newcastle disease, An Avian Paramyxovirus In Newcastle disease Edited by: Alexander DJ Kluwer Acad ... result was obtained from soaked cracked maize carrier followed by soaked maize husk The maize offal was used as a control, because it is known to have been processed through water and has been ... which was soaked in water for Page of three days, with a daily change of water (1:3; w/v) After the third day, it was sun-dried on a clean and well washed surface this was for the birds in cage...
Ngày tải lên: 12/08/2014, 04:20
Use of lactococcus lactis as a mucosal vaccine delivery vehicle
... injuries and elevated alanine aminotransferase and aspartate aminotransferase These observations mimic the liver alterations in dengue infected humans (Paes et al., 2005) Atrasheukay and co-workers ... there are vaccines against JEV used by the Asia-Pacific region BIKEN (Osaka, Japan) produces one vaccine based on the wild-type Nakayama or Beijing-1 strains grown in adult mouse brains and China ... oral administration of L lactis strains Detection of anti-L lactis IgG antibodies in the serum of BALB/c mice after nasal administration of L lactis strains Detection of anti-L lactis IgG antibodies...
Ngày tải lên: 04/10/2015, 16:12
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx
... _ Name one important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe...
Ngày tải lên: 21/12/2013, 19:15
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc
... _ Name one important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe...
Ngày tải lên: 18/01/2014, 04:20
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... of manual tagging Natural Language Engineering J Carletta 1996 Assessing agreement on classification tasks: The kappa statistic Computational Linguistics, 22(2):249-254 W Chafe 1986 Evidentiality ... m a t e s of these parameters are obtained, each clause can be assigned the most probable latent category given the tags assigned by the judges The EM algorithm takes as input the number of latent ... Table can be found in the marginal totals, ni+ and n+j We see that judge has a relative preference, or bias, for objective, while judge has a bias for subjective Relative bias is one aspect of...
Ngày tải lên: 23/03/2014, 19:20
báo cáo hóa học: " A pilot study evaluating use of a computer-assisted neurorehabilitation platform for upper-extremity stroke assessment" pptx
... area in this task was thus large, consisting of a screen-centered rectangle with 40% width and height of the workspace Data and statistical analysis Representative tasks were analyzed across subjects ... performance metrics, developed using a low-cost computer-assisted platform, have as enough usability and sensitivity for use as assessment tools for a home rehabilitation as a component within a larger-scale ... perturbation as much as possible The pseudo-random perturbation was generated by an algorithm which ensured that the amplitude of the force has an equal opportunity to be set among the negative maximum...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx
... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 301 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA ... CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG P S Y V G T N N E Y R I S L A K AAAGGTGGCGGCTGTCCCGTGATGAACCTGCACGCCGAATACACCACT K G G G C P V M N L H A E Y T T TCGTTTGAGAGTTTCATCGACAAGGTGATATGGTACAACTTTTACAAG S F E...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc
... that the Platelia™ Dengue NS1 AG assay can be use as a surrogate, easy and fast method for the semiquantitation of DEN in cultured cells Reliable levels of NS1 protein for quantitation are usually ... immunoassay, Platelia™ Dengue NS1 AG (Bio-Rad Laboratories), was developed for the detection of NS1 antigen in human serum or plasma This assay has been reported to be useful for the diagnosis of ... search of alternative semiquatitative methods Recently, a flow cytometrybased assay and a fluorescent focus assay for flavivirus quantitation have been reported [10,11] Results An attractive alternative...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt
... (pGL3-control), and relative luciferase activity was measured To account for potential differences in host cell transcription factors that mediate activation of the reporter plasmid, the assay was flipped and ... protein This assay has multiple applications For example, this assay can be used as a means of studying the structure-function of the HRSV F protein, or for evaluating the activity of mutations in ... from a known infectious cDNA sequence for subgroup A, A2 strain, [34] was synthesized with optimal codon usage for expression in mammalian cells and all potential polyadenylation sites (AATAAA) and...
Ngày tải lên: 20/06/2014, 04:20
USE OF A SOAKING PROCEDURE TO IMPROVE DRY BEAN ATTRIBUTES - MILESTONE 7 pdf
... between days and in treatment five, pH and titrable acidity values of pulp had an apparent anomaly of both rising from day to in this treatment This may be associated with a change in organic acid ... for each day of all fermentation treatments It can also be noted that the lower the pH of un-washed cocoa is, the greater the elevation of pH caused by washing With un-washed cocoa, it was surprising ... on each day of the fermentation sampled pH values tended to decrease with length of fermentation time West African cocoa usually has a pH of around 5.1 The results indicate that a fermentation...
Ngày tải lên: 21/06/2014, 06:20
Cutting Tool Materials What is the use of a book docx
... crystalline grains can be either ‘beta-Sialon’ , or a mixture of ‘alpha’ and ‘beta’ , but generally it can be said that as the ‘alpha’ phase increases, the hardness of the ‘Sialon’ becomes greater ... the hardness of different popular coatings may be applicable here, as TiCN coating has a hardness of around 2,700 HV and TiAlN coating has a hardness of approximately 3,200 HV 24 Chapter Figure ... plotted against hardness to indicate the range of influence of each tool material and the comparative relative merits of one material against another, with some of their physical and mechanical properties...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps
... in managing the child’s behaviour and psychoeducational materials are made available When pharmacological therapy is recommended, the various types of medication available and their risks and ... neurological examination was normal Patient had a diagnostic assessment for ADHD and was found to have very high scores for inattention, hyperactivity and impulsivity, leading to a diagnosis of ADHD ... delivery, and had a history of delay in all areas of her development; she walked late, talked late (age 3) and found mainstream schooling very challenging Patient 4’s parents separated when she was...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx
... had closed In another case, a sampled provider was later determined to actually represent a professional affiliation of three individual providers Although specific reasons for not participating ... AIDS case to the health department; some providers of care may have been left off the sampling frame if they had never reported an HIV case However, two of the participating states had laboratory ... reporting of at least some CD4 counts and viral loads at the time of the study and the third had an established, clinically-based HIV reporting system that had been in place and integrated with AIDS...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Severe leukocytoclastic vasculitis secondary to the use of a naproxen and requiring amputation: a case report" ppt
... clinical, laboratory, and multispecialty collaboration, no alternative diagnosis applied to our patient We reiterate that amputation in this scenario was an unfortunate and Page of debilitating last ... disease Noting the atypical nature of the case of LCV or HSV, the authors feel that the realization of paucity of cases with more severe outcomes may encourage additional research in the area of ... during active inflammatory disorders of vessels [16] Conclusion We have presented an atypical case of leukocytoclastic vasculitis in a 33-year-old African American woman secondary to the use of naproxen...
Ngày tải lên: 11/08/2014, 11:20
báo cáo khoa học: " A radiographic analysis of tooth morphology following the use of a novel cyclical force device in orthodontics Chung H Kau" pps
... Image manipulation was carried out using the manufacturer’s software, Galaxis To increase the accuracy of the assessment, all three planes (sagittal, axial, and coronal) were utilized CBCT images ... surrounding bony areas facilitating a variable response to tooth movement [5] In another study, it has been reported that low magnitude mechanical signals are “anabolic” to bone when applied at a high ... evaluating root resorption is through conventional radiography Some examples are panoramic radiography or peri-apical films However, these models may be of limited use A more Page of accurate...
Ngày tải lên: 11/08/2014, 20:21
báo cáo khoa học:" Quality of life of children and their caregivers during an AOM episode: development and use of a telephone questionnaire" pps
... six domains The OM-6 also contains a visual analog scale of happy and sad faces allowing the caregiver to rate their child QOL on a 10-point scale This was Descriptive statistics were generated ... Internal consistency of scores was measured by Cronbach’s alpha Inter-item correlations were calculated to reveal any redundancy in measured items and corrected item-total correlations (sum of the ... development and used of a telephone questionnaire designed to measure the severity of AOM and its consequences on the QOL of the child and of the caregiver and its use in a country-wide survey in Canada...
Ngày tải lên: 12/08/2014, 01:21