shp as a mediator of negative transcriptional regulation by fxr

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of transcription (JAK-STAT) pathway, to promote proliferation, survival and transformation [56,57] The importance ... protein kinase ⁄ extracellular signal-regulated kinase kinase ⁄ kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacodynamic relationship, and potential for combination in preclinical models ... pathway modulated by cytokines Cancer Biol Ther 6, 912–919 66 Kuroda J, Kimura S, Strasser A, Andreef A, O’Reilly LA, Ashihara E, Kamitsuji Y, Yokota A, Kawata E, Takeuchi M et al (2007) Apoptosis-based...

Ngày tải lên: 16/03/2014, 00:20

13 453 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

... in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed proposal for ... likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased by non-random missing data patterns (n ... that physical activity partially mediates the impact of chronic conditions on several health outcomes that are important to quality of life Physical activity of at least 1,000 Kcal per week was...

Ngày tải lên: 18/06/2014, 22:20

11 619 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

... TGTGGATGCCTCTGGGTATC ADAMTS- Forward: GACCTTCCGTGAAGAGCAGTGT 58 Reverse: CCTGGCAGGTGAGTTTGCAT ADAMTS- Forward: CCTGGCAGGTGAGTTTGCAT 60 Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 ... program for MATLAB software (Natick, MA, USA) by an orthopedic researcher who was blinded to the treatment groups The average of the disc height index (DHI) was calculated as a ratio of the average ... to assess gene expression Gene Primer sequence (5’ to 3’) Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC...

Ngày tải lên: 12/08/2014, 17:22

9 402 0
Báo cáo y học: "Dynamic cumulative activity of transcription factors as a mechanism of quantitative gene regulation" docx

Báo cáo y học: "Dynamic cumulative activity of transcription factors as a mechanism of quantitative gene regulation" docx

... of combinatorial regulation in yeast transcriptional networks: a case study of sporulation Proc Natl Acad Sci USA 2005, 102:1998-2003 Wingender E, Dietze P, Karas H, Knuppel R: TRANSFAC: a database ... mechanisms of quantitative combinatorial gene regulation, we have considered all the factors mentioned above By assuming a combinatorial mode of transcription factor activity as the principle of ... potential quantitative mechanisms of target gene activation, use can be made of gene expression data and knowledge of the available transcriptional gene network of yeast [18-20] A number of recent...

Ngày tải lên: 14/08/2014, 08:20

18 273 0
Trait Mindfulness as a Mediator of Resilience Depressive Symptom

Trait Mindfulness as a Mediator of Resilience Depressive Symptom

... Psychological Services, Alpharetta, GA Advanced Therapy Practicum Grady Health System, Atlanta, GA Therapy Practicum Grady Health System, Atlanta, GA Therapy Practicum YWCA of Northwest Georgia, Marietta, ... trauma, tragedy, threats or even significant sources of threat.” As research has accumulated in this area, various factors such as socioeconomic advantage, family history of mental health, maltreatment, ... (Psychotherapy) Affiliate Counseling Psychology Student Organization, GSU Graduate Student Affiliate of American Psychological Association ABSTRACT TRAIT MINDFULNESS AS A MEDIATOR OF RESILIENCE,...

Ngày tải lên: 10/12/2016, 17:16

105 149 0
Abstract construal of top leaders  respect as a mediator

Abstract construal of top leaders respect as a mediator

... develop a Leader Behavior Construal Scale (LBCS) The goal was to have an instrument that can assess the level at which a leader is represented The study was patterned after that of Vallacher and ... perception of a leader is matched against an abstract prototype of a leader and this prototype is more equivalent to a high-level construal category (or abstract category) as in the case of topboss (Cantor ... the same object at near and distant locations (e.g., Berti & Fassinetti, 2000; Halligan, Fink, Marshall, & Vallar, 2003) Construal as a function of hypotheticality and probability Bar-Anan, Liberman,...

Ngày tải lên: 15/09/2015, 21:09

129 149 0
Cardiovascular responses as a function of ethnicity, gender, 5HTTLPR genotype, dispositional anger and negative affect

Cardiovascular responses as a function of ethnicity, gender, 5HTTLPR genotype, dispositional anger and negative affect

... leading cause of death after cancer (Seow & Lee, 1994) As of 1999, Singapore’s age-standardized CHD death rate (100/100,000) was among the highest of Southeast Asian nations (higher than Japan (22/100,000) ... situational anger Additionally, increasing levels of OA related to increased HR for males, however females showed decreased HR A final three-way interaction showed increasing levels of negative affect ... rate that was 1.81 times higher than Malay males and 2.69 times higher than Chinese males (Registry of Births and Deaths, 1991) Malay males had an average hypertension mortality rate that was...

Ngày tải lên: 02/10/2015, 22:48

143 202 0
Reading Theory as a Microcosm of the Four Skills

Reading Theory as a Microcosm of the Four Skills

... is in their emphasis It is my belief that in giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, we, as teachers give the ... Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely central Even with as few details as we ... predominantly lie in the area of reading University systems in Europe, unfortunately, are dominated by the grammar-translation method of language teaching, where, as often as not, English is only taught...

Ngày tải lên: 06/09/2013, 10:10

5 680 0
Social Phobia as a Consequence of Brain Defects

Social Phobia as a Consequence of Brain Defects

... (accepting) accepting and negative and neutral expresssions: activation accompanied by in amygdala, evaluation of: hippocampus, Task performance: parahippocampal recognition of gyrus, medial type of emotion ... physical signs with imbalances in autonomic neurotransmission In this formulation, the physical complaints typical of social phobia, are associated with rapid release of catecholamines (noradrenaline, ... circuit (amygdala, hippocampus, insula, temporal lobe as well as anterior cingulate, medial, orbito, and dorsolateral prefrontal cortices) of social phobic patients are greater than those of controls...

Ngày tải lên: 01/11/2013, 08:20

41 429 0
Social Phobia as a Consequence of Cognitive Biases

Social Phobia as a Consequence of Cognitive Biases

... let alone as evidence of a bias However that may be, this putative ‘‘bias’’ is assigned a role of some importance as it is proclaimed to necessitate a correction by means of cognitive therapy ... instance of a ‘‘category mistake.’’ According to Ryle (1949) this logical fallacy consists of treating the label for a class of events as if it were a member of that class From this vantage point ... conclusions Ranking order results are transformed into a score by summation and the data are subsequently treated as if originating in a scale of equal intervals This violates the basic postulates of the...

Ngày tải lên: 01/11/2013, 08:20

41 493 0
Social Phobia as a Consequence of Inadequate Social Skills

Social Phobia as a Consequence of Inadequate Social Skills

... definitions aside, I shall now consider how the construct of social skills has been assessed in research Assessment of Social Skills of Social Phobic Individuals As the assessment of social skills had ... value of matching treatment with patients’ patterns of fear Based on extreme responses to a role-play and a ‘‘rationality’’ test, 39 patients were classified as either predominantly behavioral ... consider social phobia not as a breakdown in social ability but as emerging out of a pattern of meaningful actions that constitute a means to an end Although not necessarily abnormal in themselves,...

Ngày tải lên: 01/11/2013, 08:20

21 461 0
Social Phobia as a Consequence of Individual History

Social Phobia as a Consequence of Individual History

... the laboratory, assessment of classroom (shy, anxious) behavior by the teacher as well as peer assessment of social behavior (popularity, aggression, and isolation) at school At the age of no association ... non-human animals (comparative ethology) 276 What Causes Social Phobia? The attachment theory maintains that the human infant has a set of preadapted behaviors that will unfold with maturation ... social phobia) has been put forward as such a temperamental trait This trait, labeled ‘‘behavioral inhibition’’ (probably an equivalent of withdrawal, in the Chess & Thomas, 1987 terminology), has...

Ngày tải lên: 01/11/2013, 08:20

41 506 0
Social Phobia as a Disorder of Social Anxiety

Social Phobia as a Disorder of Social Anxiety

... configurations of any pattern are limited both by what society 44 What is the Nature of Social Phobia? (and particularly the family) dictates and by which basic emotions are developmentally available’’ ... the validity of the measures devised to ascertain and quantify social anxiety, as this is most relevant to social phobia Examination of the validity both of the construct and of the methods assessing ... anywhere The danger was manifest to the senses only in the alarming information disseminated by various media While anthrax is not contagious, fear (or anxiety) as well as courage clearly are Vast numbers...

Ngày tải lên: 01/11/2013, 08:20

40 573 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively...

Ngày tải lên: 29/01/2014, 10:33

39 1,1K 3
Tài liệu Father’s Involvement as a Determinant of Child Health pptx

Tài liệu Father’s Involvement as a Determinant of Child Health pptx

... some of the outcomes shown on Table and some of the factors accepted by the Public Health Agency of Canada (PHAC) as determinants of health (PHAC, 2003) PHAC has adopted a conceptual model of health ... stratifying by maternal race, age, adequacy of prenatal care and medical risks, and congenital malformations, birthweight, gestational age, and small-for-gestational age The study by Gaudino et al (1999) ... understandings of health as multiply and reciprocally determined by a broad array of biological and nonbiological factors For example, the World Health Organization (WHO) defines health asa state of complete...

Ngày tải lên: 12/02/2014, 11:20

36 820 0
Tài liệu Traumatic Gynecologic Fistula as a Consequence of Sexual Violence in Conflict Settings: A Literature Review doc

Tài liệu Traumatic Gynecologic Fistula as a Consequence of Sexual Violence in Conflict Settings: A Literature Review doc

... but at least acknowledge it as a potential outcome of sexual assault: • An online publication by the UN Office for the Coordination of Humanitarian Affairs lists fistula as one of the physical ... where thousands of women and girls as old as grandmothers and as young as toddlers—have suffered brutal sexual violence at the hands of military and rebel forces Rape is often accompanied by other ... sexually assaulted, which often results in social stigmatization As victims of violent sexual assault, women with traumatic fistula may have sustained additional physical injuries They also face...

Ngày tải lên: 12/02/2014, 23:20

33 842 0
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

... phonology of languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons ... Subdivisions of Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, ... Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences of the migrations of races and nations a The Eurafrican Race.—Types of the white race Its first home Early migrations The...

Ngày tải lên: 13/02/2014, 05:20

28 666 0
Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

... that in writing of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as ... much of a business man after all He must still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft! ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with...

Ngày tải lên: 17/02/2014, 19:20

21 544 0
w