short introduction to density functional theory

Development of multivariate curve resolution and associated system identification tools for IR emission, chiroptical, and far infrared and far raman spectroscopies

Development of multivariate curve resolution and associated system identification tools for IR emission, chiroptical, and far infrared and far raman spectroscopies

... vectors of VT Matrix for consolidated data set: (1)~(6) first six right singular vectors; (7) tenth right singular vector; (8) twentieth right singular vector; (9) thirtieth right singular vector; ... procedures of SMCR is first to use factor analysis (FA) or principal component analysis (PCA) methods to abstract the eigenvectors of the covariance matrix A and then to use either iterative or ... it is highly desirable to decompose the data matrix into several independent and orthogonal vectors which can be use to represent the system with a smaller set of basis vectors Such independent...

Ngày tải lên: 12/09/2015, 08:20

260 402 0
Tài liệu Selecting the Top n Rows in a DataTable doc

Tài liệu Selecting the Top n Rows in a DataTable doc

... String topNFieldName = FREIGHT_FIELD; int topN = 0; try { topN = Convert.ToInt32(topNTextBox.Text); if(topN

Ngày tải lên: 14/12/2013, 18:16

4 332 0
Tài liệu Murray N. Rothbard - History Of Money And Banking In The United States (pdf) pptx

Tài liệu Murray N. Rothbard - History Of Money And Banking In The United States (pdf) pptx

... man to substitute more satisfactory conditions for less satisfactory ones Ideas determine what are to be considered more and less satisfactory conditions and what means are to be resorted to to ... relationship between theory and history It is Rothbard’s great contribution in this volume—and his earlier America’s Great Depression to be the first to consistently apply it to economic history.4 It is ... order to correctly identify the causal relevance of a particular action to a historical event, to trace out its specific consequences, and to evaluate its success from the point of view of the actor’s...

Ngày tải lên: 17/01/2014, 02:20

510 1,2K 0
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

... Solution: v = 88.514 km hr m v = 24.6 s Problem 1-9 Convert: (a) S1 to N ⋅ m , (b) S2 to kN/m3, (c) S3 to mm/s Express the result to three significant figures Use an appropriate prefix Units Used: ... post is to be pulled out of the ground using two ropes A and B Rope A is subjected to force F and is directed at angle θ1 from the horizontal If the resultant force acting on the post is to be ... y' = 40.8 lb Problem 2-25 The boat is to be pulled onto the shore using two ropes Determine the magnitudes of forces T and P acting in each rope in order to develop a resultant force F1, directed...

Ngày tải lên: 17/02/2014, 14:20

1,1K 1,1K 2
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Porin Mito TIM23 2E1 pPut2 Mitoplast 2E1 0 0 25 0 Digitonin%: Mito B 50 25 0 25 0 - 0 Trypsin (µg/mL): Mitoplast Supernatant Pellet Mito PUT2 C Pellet Sup 2E1 CCPO Mito TIM23 Mito pPut2 Mito Micro ... Mito pPut2 Mito Micro 2E1 Mitoplast Mito Mitoplast Mito TOM20 Mitoplast Fig Intramitochondrial localization of CYP2E1 in transformed yeast cells (A) Mitochondria and mitoplasts from cells expressing ... of CYPs to the ER and mitochondria, Alzheimer’s amyloid precursor protein to the plasma membrane and mitochondria, and translocation of the cytosolic glutathione S-transferases to the mitochondrial...

Ngày tải lên: 18/02/2014, 16:20

16 651 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

... from E to Y at amino acid residue 31 (Fig 1), and a mutant form of the variant (P79S) Copper was found to bind to stefin B at pH but not to stefin A (Fig 2) The binding isotherm data were fitted to ... of binding sites to be fitted in a sequential manner Attempts to fit data to anything other than one or two identical site models gave unsatisfactory results The affinity of copper to glycine was ... oligomers ⁄ aggregates, which persist during the lag phase The prefibrillar forms were shown to be cytotoxic and to interact with acidic phospholipids [8] Human stefin B, officially termed cystatin B (subfamily...

Ngày tải lên: 19/02/2014, 06:20

14 586 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

... that the flavin cofactor was not covalently bound to the protein and thin layer chromatography 1530 (TLC) indicated that the cofactor was FAD (not shown) Gel permeation chromatography revealed that ... responsive to nicotine and nicotine metabolites are feasible [5] To achieve such goals, an in-depth understanding of the enzymology of nicotine catabolism is required Our effort is directed towards ... was specific towards CH3-4-aminobutyrate and its monoamine oxidase activity with 4-aminobutyrate as substrate was weak Similar to other members of the polyamine oxidases, the FAD cofactor was noncovalently...

Ngày tải lên: 19/02/2014, 07:20

9 525 0
Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

... were used to change the R120 to a lysine and a valine, respectively (the codon changes are underlined): 5¢-primer (R to K): 5¢-GGT TGCGCCATTGGCGCGAAACCTGTTGACCTGC ATATC-3¢; 3¢-primer (R to K): 5¢-GATATGCAGGTCA ... prior to digestion The mass peak of 1616 (m/z) is due to the peptide of amino acids 104– 120 and on binding of fosfomycin this mass shifts to 1754 (m/z) The peak at 1657 (m/z) is attributed to the ... it is not possible to calculate how much of the heat capacity change is due to hydration effects Also, the lack of a binary structure does not allow us to evaluate the extent to which the conformational...

Ngày tải lên: 19/02/2014, 13:20

9 708 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

... transfectants In order to produce stable transfectans, each plasmid DNA (2–4 lg) was transfected into · 105 CHO cells using the Eppendorf Multiporator and an appropriate Eppendorf protocol (Wesseling-Berzdorf, ... Yamamoto M & Saito N (1995) Immunocytochemical localization of three subtypes of GABA transporter in rat retina Brain Res Mol Brain Res 33, 319– 325 10 Bennett ER & Kanner BI (1997) The membrane topology ... were normalized to the transporter proteins in the plasma membrane, the reduced specific activities of the mutants are not due to a reduced number of GABA transporters per cell, but to a reduced...

Ngày tải lên: 19/02/2014, 17:20

14 655 0
Tài liệu Báo cáo khoa học: Changes in rat liver mitochondria with aging Lon protease-like activity and N e-carboxymethyllysine accumulation in the matrix doc

Tài liệu Báo cáo khoa học: Changes in rat liver mitochondria with aging Lon protease-like activity and N e-carboxymethyllysine accumulation in the matrix doc

... plays a key role in maintaining mitochondrial integrity All together, these age-dependent alterations may contribute to disadvantage aged mitochondria to respond to conditions of stress and compromise ... mitochondrial matrix and that their recruitment varies with aging Discussion We used isolated rat liver mitochondria to analyse the matrix defects that occur with aging Mitochondria, similar to ... Results Age-related changes in the structure and respiratory function of isolated mitochondria As shown in Table 1, there was no difference in mitochondrial oxygen consumptions between 10-month- and...

Ngày tải lên: 20/02/2014, 11:20

8 413 0
Báo cáo khoa học: Conserved residues in the N-domain of the AAA+ chaperone ClpA regulate substrate recognition and unfolding pdf

Báo cáo khoa học: Conserved residues in the N-domain of the AAA+ chaperone ClpA regulate substrate recognition and unfolding pdf

... stopped by rapidly lowering the pH to 2.4 at °C All subsequent steps were carried out on ice to minimize back exchange The proteins were separated on a micro-C4RP column connected to an ESI-QTOF ... mutant to bind to the various substrates tested To this, we constructed a ClpA variant in which the glutamic acid residue within the Walker B motif of each AAA domain (E286, E565) was changed to ... N-domain to the D1 domain In order to avoid the potential problems associated with ‘ragged’ ends of DNClpA, we chose to create several single and double point mutations within the N-domain to probe...

Ngày tải lên: 07/03/2014, 05:20

11 434 0
Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

... sensitive to ion gradients Ca2+ influx would trigger apoptosis and alter signaling If amyloid toxin could disrupt mitochondrial membranes, this again may lead to apoptosis The channels were predicted to ... oligomers of A-b up to tetramers were shown to change neural plasticity and block long-term potentiation (LTP) [38], without extensive cell death Toxicity to cells is not limited to amyloidogenic ... amyloid pathology, is toxic to cells We have also shown that the toxic effects of stefin B are correlated to its interaction with acidic phospholipids, found predominantly in the cytosolic site of the...

Ngày tải lên: 07/03/2014, 17:20

10 477 0
Báo cáo khoa học: An arginyl in the N-terminus of the V1a vasopressin receptor is part of the conformational switch controlling activation by agonist docx

Báo cáo khoa học: An arginyl in the N-terminus of the V1a vasopressin receptor is part of the conformational switch controlling activation by agonist docx

... the neurohypophysial hormone receptor family; for example, the distal N-terminus is required for agonist binding to the OTR [11,12] and also to the vasotocin receptor [13], suggesting a common role ... conformational switch mechanism which controls conversion of inactive V1aR to active receptor in response to AVP Experimental procedures by automated fluorescent sequencing (Alta Bioscience, Birmingham, UK) ... 10-fold to 600-fold compared to the wildtype V1aR (Fig 3B) The acidic residues at position 46 in [R46E]V1aR and [R46D]V1aR were the most detrimental to signalling This effect was due predominantly to...

Ngày tải lên: 07/03/2014, 21:20

8 487 0
Báo cáo khoa học: Functional symmetry in the isolated domain demonstrated by N-ethylmaleimide labelling pdf

Báo cáo khoa học: Functional symmetry in the isolated domain demonstrated by N-ethylmaleimide labelling pdf

... Prism, to the equation: ðtop À bottomÞ y ¼ bottom þ n þ 10ðlog IC50Àlog x Þ where y ¼ percentage of reference signal, x ¼ nucleotide concentration, bottom ¼ minimum labelling intensity, top ¼ ... Binding of steroid modulators to recombinant cytosolic domain from mouse P-glycoprotein in close proximity to the ATP site Biochemistry 36, 15208–15215 40 de Wet, H., McIntosh, D.B., Conseil, G., ... soaked in AMPLIFYÒ (Amersham, UK) Gels were then dried on to Whatman mm paper and exposed to photographic film (Kodak, MR1 film) at )80 °C To investigate if nucleotide preincubation can prevent N-[3H]ethylmaleimide...

Ngày tải lên: 08/03/2014, 08:20

10 386 0
Báo cáo khoa học: Identification of two cysteine residues involved in the binding of UDP-GalNAc to UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) ppt

Báo cáo khoa học: Identification of two cysteine residues involved in the binding of UDP-GalNAc to UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) ppt

... GalNAc-T1 is totally insensitive to DFP treatment, and thus appears not to contain any serine residues important for enzyme function By contrast, all three serine mutants were inactivated by DFP to some ... N-acetylgalactosaminyltransferase, GalNAc-T8, and analysis as a candidate autosomal dominant hypophosphatemic rickets (ADHR) gene Gene 246, 347–356 Toba, S., Tenno, M., Konishi, M., Mikami, T., Itoh, ... by rechromatography on a C8 column and sequenced with an automated Edman sequencer Kinetic analysis Km for UDP-GalNAc was obtained by varying the concentration of UDP-GalNAc from 1.5 to 43.5 lM...

Ngày tải lên: 08/03/2014, 10:20

9 436 0
Báo cáo khoa học: Characterization of N-glycosylation consensus sequences in the Kv3.1 channel pot

Báo cáo khoa học: Characterization of N-glycosylation consensus sequences in the Kv3.1 channel pot

... voltage protocols in which current amplitudes were reported to be less than 100 pA [13,32] Deactivation protocols were conducted by stepping to +40 mV (25 ms) and then stepping from ) 110 mV to mV ... Beckman 70Ti rotor for 1.5 h to concentrate the fractions The pellet was solubilized in 200 lL of resuspension buffer (50 mm Na2HPO4, 0.3 m KCl, pH 7.4, 0.5% Triton X-100) and transferred to microcentrifuge ... to be more similar to those of unglycosylated Kv3.1 than to that of the glycosylated channel Thus, these results indicate that the occupancy of the N-glycosylation sites is a determining factor...

Ngày tải lên: 16/03/2014, 13:20

14 406 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... involved in cotranslational protein N-myristoylation and N-acetylation [18,20,27], the use of this system to study cotranslational protein N-myristoylation seems to be appropriate Using this assay system, ... Methods essentially identical to those described previously were employed [28] T3 polymerase was used to obtain transcripts of these cDNAs subcloned into pB vector These transcripts were purified ... densitometer (Bio-Rad GS-700) Results Effect of the amino acid residue at position in the N-myristoylation consensus motif on the efficiency of the cotranslational N-myristoylation reaction To determine...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: Alternative initiation of transcription of the humanpresenilin 1gene in SH-SY5Y and SK-N-SH cells The role of Ets factors in the regulation ofpresenilin 1 pptx

Báo cáo khoa học: Alternative initiation of transcription of the humanpresenilin 1gene in SH-SY5Y and SK-N-SH cells The role of Ets factors in the regulation ofpresenilin 1 pptx

... downstream motif Sp1 factors have been known to activate transcription and to form synergistic interaction with Ets factors binding at adjacent sites [31] The specific factors that transactivate ... primer), to direct integration into the cloning vector (restriction sites 5¢ flanking sequence 15 shown in lowercase) PCR products were purified, digested with MluI and SalI and inserted into the ... gel mobility shift assays (EMSAs) To assay the binding of Ets factors to the PS1 promoter, the proteins were synthesized from the corresponding pCIbased vectors by in vitro transcription–translation...

Ngày tải lên: 16/03/2014, 18:20

10 493 0
Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx

Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx

... process is still far from equilibrium To assess this hypothesis, we monitored the reverse process, namely the interconversion of MxM into M¼M, for P19A-BS-RNase To isolate the MxM dimer, the equilibrium ... proteins were submitted to mild reduction, which selectively removes the glutathione molecules linked to Cys31 and 32, followed by air oxidation and gel filtration on Sephadex G-75 to obtain the corresponding ... 4.1 to RNase A, which has a thermal stability higher than that of mBS However, P19A/L28Q-mBS has the same thermal stability of the parent protein, in spite of greater similarity to RNase A To...

Ngày tải lên: 16/03/2014, 23:20

7 404 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

... experiments and other topics related to biochemistry We wish to dedicate this work to him as a sign of immense regard for our former adviser, colleague and friend We are grateful to Jose Luis Burgos ... protein was recovered together with D123; lane 2, recovered D123 bound to Ni2+ resin; lane 3, absence of CD rules out nonspecific binding to the resin (control) At the bottom of each lane, a western ... relationship and regulatory properties of the enzymes involved in its production, may provide a powerful tool for the planning of new strategies to increase plant biomass, as well as to improve the quality...

Ngày tải lên: 22/03/2014, 21:20

13 457 0
w