severe invasive group a streptococcal infections

Nhiễm Trùng Streptococcal Nhóm A - Group A Streptococcal Infections

Nhiễm Trùng Streptococcal Nhóm A - Group A Streptococcal Infections

... ng a nhiễm trùng streptococcal nhóm A?  R a tay thường xuyên Muốn biết thêm chi tiết r a tay, đọc HealthLinkBC File #85 R a Tay cho Cha Mẹ Trẻ Em  Đừng dùng chung ống hút, ly tách, chai, n a, ... nhiễm trùng GAS lan tràn quý vị cần thuốc trụ Muốn biết thêm đề tài HealthLinkBC vào www.HealthLinkBC.ca/healthfiles đến phòng y tế công cộng đ a phương quý vị Bấm vào www.HealthLinkBC.ca gọi số ... tách, n a, th a (muỗng) hút chung điếu thuốc Cách điều trị nhiễm trùng streptococcal nhóm A nào? Nhiễm trùng GAS điều trị thuốc trụ sinh Điều quan trọng phải uống hết thuốc trụ sinh kê toa uống...

Ngày tải lên: 21/07/2015, 20:58

2 160 0
báo cáo khoa học:" Preferences for health outcomes associated with Group A Streptococcal disease and vaccination" pps

báo cáo khoa học:" Preferences for health outcomes associated with Group A Streptococcal disease and vaccination" pps

... data, drafting of the manuscript, statistical analysis, and the obtaining of funding JS participated in the conception and design, analysis and interpretation of data, statistical analysis, and ... A, Cieslak PR, Lynfield R, Gershman K, Craig A, Albanese BA, Farley MM, Barrett NL, Spina NL, et al: The epidemiology of invasive group A streptococcal infection and potential vaccine implications: ... Reddish MA, Hu MC, Wasserman SS, Dale JB: Safety and immunogenicity of a recombinant multivalent group a streptococcal vaccine in healthy adults: phase trial Jama 2004, 292(6):709-715 McNeil SA, Halperin...

Ngày tải lên: 12/08/2014, 01:21

7 786 0
Báo cáo y học: "Neonatal retroauricular cellulitis as an indicator of group B streptococcal bacteremia: a case report" ppt

Báo cáo y học: "Neonatal retroauricular cellulitis as an indicator of group B streptococcal bacteremia: a case report" ppt

... Una presentación infrecuente de infección tard a por streptococcus agalactiae Revista chilena de pediatr a 2004, 75:455-458 Chakkarapani E, Yoxall C, Morgan C: Facial submandibular cellulitis-adenitis ... includes parenteral antibiotics for 10 to 14 days Nowadays, the duration of the antimicrobial therapy may be guided by clinical and patient responses to acute phase reactants (especially C-reactive ... indicador de bacteriemia An Esp Pediatr 2002, 56:251-252 Barton LL, Ramsey RA, Raval DS: Neonatal group B streptococcal cellulitis-adenitis Pediatr Dermatol 1993, 10:58-60 Bustos R: Síndrome adenitis-celulitis:...

Ngày tải lên: 11/08/2014, 14:21

3 411 0
Tài liệu Credit Suisse Group A brief presentation ppt

Tài liệu Credit Suisse Group A brief presentation ppt

... investment banking platform in Canada, maintained or improved market share in most major product areas in the US, and expanded our Private Banking & Wealth Management capabilities across the region, ... Board: Divisional and Regional Management Hans-Ulrich Meister Head Private Banking CEO Switzerland Robert Shafir Head Private Banking & Wealth Management Products CEO Americas Eric Varvel Head ... Credit Suisse Group Urs Rohner, Chairman Andreas N Koopmann Peter Brabeck-Letmathe, Vice-Chairman Jean Lanier Jassim Bin Hamad J J Al Thani Anton van Rossum Robert H Benmosche Aziz R.D Syriani Iris...

Ngày tải lên: 15/02/2014, 14:20

25 537 1
STREPTOCOCCUS (GROUP A) pdf

STREPTOCOCCUS (GROUP A) pdf

... to avoid sharing any utensils and to make sure all glasses and silverware are washed carefully in hot, soapy water DIAGNOSIS AND TREATMENT Diagnosing Primary Streptococcal Diseases Streptococcal ... asymptomatic) carriers, can serve as a source of deadly bacteria In rare cases, strep throat infections that are not treated with antibiotics (or cases that are treated, but fail to kill all the bacteria) ... pediatricians and other primary care physicians are consulted Although GABHS remains the leading bacterial cause for this acute disease, it is still the causative agent for only a minority of all...

Ngày tải lên: 06/03/2014, 07:20

113 211 1
Báo cáo khoa học: Functional interaction of Escherichia coli heat-labile enterotoxin with blood group A-active glycoconjugates from differentiated HT29 cells docx

Báo cáo khoa học: Functional interaction of Escherichia coli heat-labile enterotoxin with blood group A-active glycoconjugates from differentiated HT29 cells docx

... Functionally, differentiation was accompanied by the expression of aminopeptidase N, lactase, maltase and sucrase activities Sucrase-isomaltase is localized at the apical brush border membranes ... Tecnologica (BID 1201 ⁄ OC-AR, PICT 05–10607) ´ and Secretarı´ a de Ciencia y Tecnica de la Universidad ´ Nacional de Cordoba (SeCyT-UNC), Argentina EMG was a fellow from CONICET and GAR and CGM are ... a study was carried out to eilucidate the relationship of the ABH blood group, immunity and susceptibility to symptomatic and asymptomatic infections with V cholerae [38] An association has also...

Ngày tải lên: 30/03/2014, 10:20

10 238 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

... phylogenetic analysis Enzyme Species GenBank/EBI A transferase A transferase A transferase A (cis A/ B) transferase A- likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA Amplification was performed using the Advantage Polymerase (Clontech) with initial denaturation at 94 °C min, followed ... fucosyllactose as acceptor However, cell extracts from the double transfectants showed a high N-acetylgalactosaminyltransferase activity and a weak galactosyltransferase activity These results indicate that...

Ngày tải lên: 31/03/2014, 09:20

8 499 0
Group A Streptococcus pdf

Group A Streptococcus pdf

... R), carbohydrate và peptidoglycan Ngoài có Pili, giúp vi khuẩn bám vào tế bào biểu bì Kháng nguyên: Carbohydrat C: Đây là kháng nguyên nằm vách tế bào vi khuẩn D a vào kháng nguyên ... tách, chai, n a, thi a (muỗng), thuốc lá bất vật gì có dính nước miếng (nước bọt) Ho nhảy mũi vào bên khuỷu tay cánh tay a o, dùng khăn giấy và sau vất khăn và r a tay Giữ tất các ... và ch a trị kịp thời các bệnh đường hô hấp và ngoài da Streptococcus nhóm A - Diệt vi khuẩn Streptococcus nhóm A người mang mầm bệnh và nếu ngăn ng a các người này lai vãng các phòng...

Ngày tải lên: 27/06/2014, 01:21

24 382 1
báo cáo khoa học: "Giant right coronary artery aneurysm presenting with non-ST elevation myocardial infarction and severe mitral regurgitation: a case report" ppsx

báo cáo khoa học: "Giant right coronary artery aneurysm presenting with non-ST elevation myocardial infarction and severe mitral regurgitation: a case report" ppsx

... was discharged to rehabilitation nine days later Discussion Coronary artery aneurysm is defined as a localized area of dilatation exceeding the diameter of the adjacent Nazareth et al Journal ... rare disease process We put forward this case and the associated literature review as an example of how a giant coronary artery aneurysm was managed at our hospital in the hope that it may aid clinicians ... artery bypass grafting, as the majority of large aneurysms may contain a large amount of layered thrombus within, and any manipulation of the heart, even in the arrested state, poses a danger of...

Ngày tải lên: 10/08/2014, 23:20

4 113 0
báo cáo khoa học: "Two successful natural pregnancies in a patient with severe uterine prolapse: A case report" ppsx

báo cáo khoa học: "Two successful natural pregnancies in a patient with severe uterine prolapse: A case report" ppsx

... Gynecol 1996, 175:10-17 Daskalakis G, Lymberopoulos E, Anastasakis E, Kalmantis K, Athanasaki A, Manoli A, Antsaklis A: Uterine prolapse complicating pregnancy Arch Gynecol Obstet 2007, 276:391-392 ... our case, the patient had sexual intercourse without any vaginal pessary Conservative management with close follow-up and bed rest can alleviate clinical symptoms and reduce potential complications ... Vita and Giordano Journal of Medical Case Reports 2011, 5:459 http://www.jmedicalcasereports.com/content/5/1/459 Page of prolapse, gestational age, parity, and the patient’s preference A vaginal...

Ngày tải lên: 10/08/2014, 23:20

3 202 0
Báo cáo y học: "Giant hepatocellular adenoma as cause of severe abdominal pain: a case report" pot

Báo cáo y học: "Giant hepatocellular adenoma as cause of severe abdominal pain: a case report" pot

... transformation of an HCA is fairly low, it may occur, and would be an important indication for a surgical approach In any case, this treatment is not particularly invasive, is well-tolerated and ... pre-contrast CT scans, HCA has a varied and non-specific appearance, possibly with hypoattenuating areas due to the presence of fat, previous haemorrhage or necrosis, whereas recent haemorrhage or large ... pain in the upper abdominal quadrants with abdominal distress, and may lead to spontaneous rupture or haemorrhage and, in certain rare cases, even death Several diagnostic procedures, such as...

Ngày tải lên: 11/08/2014, 10:22

4 420 0
Báo cáo khoa hoc:" Giant hepatic hydatid cyst with sub-fascial extension treated by open minimally invasive surgery: a case report" potx

Báo cáo khoa hoc:" Giant hepatic hydatid cyst with sub-fascial extension treated by open minimally invasive surgery: a case report" potx

... Palanivelu C, Jani K, Malladi V, Senthilkumar R, Rajan PS, Sendhilkumar K, Parthasarthi R, Kavalakat A: Laparoscopic management of hepatic hydatid Disease JSLS 2006, 10:56-62 Dervenis C, Delis S, Avgerinos ... and hospital stay was reduced The percutaneous laparoscopic approach has been adopted by Kayalp et al to deal with a liver abscess pointing onto the anterior abdominal wall in which the trocar ... advantages of laparoscopic surgery We could evacuate a giant hepatic hydatid cyst without intraperitoneal spillage, visualize the cavity and drain it through a small abdominal incision Postoperative...

Ngày tải lên: 11/08/2014, 10:23

5 278 0
Báo cáo y học: " A well-being support program for patients with severe mental illness: a service evaluation" docx

Báo cáo y học: " A well-being support program for patients with severe mental illness: a service evaluation" docx

... carried out the service evaluation and contributed to data analysis RG analyzed the data and drafted the manuscript All authors read and approved the final manuscript Competing interests Donna ... pathology laboratory Practitioners may have also failed to place appropriate emphasis on communicating the importance of laboratory testing with patients Qualitative feedback from practitioners emphasized ... of the WSP Rates of cardiovascular risk factors at baseline (for the group as a whole and for completers) and at the final (one year) consultation are shown in Table Results for laboratory tests...

Ngày tải lên: 11/08/2014, 16:23

9 316 0
Báo cáo y học: "Concentration of acrylamide in a polyacrylamide gel affects VP4 gene coding assignment of group A equine rotavirus strains with P[12] specificity" pdf

Báo cáo y học: "Concentration of acrylamide in a polyacrylamide gel affects VP4 gene coding assignment of group A equine rotavirus strains with P[12] specificity" pdf

... DE, Lamb RA, Martin MA, Roizman B, Straus SE Philadelphia, PA: Lippincott Williams and Wilkins; 2007:1917-74 Saif LJ, Rosen BI, Parwani AVL: Animal rotaviruses In Viral Infections of the Gastrointestinal ... Kapikian AZ: Isolation, propagation, and characterization of a second equine rotavirus serotype Infect Immun 1983, 41:1031-7 Hoshino Y, Gorziglia M, Valdesuso J, Askaa J, Glass RI, Kapikian AZ: An ... 64:313-20 Kalica AR, Greenberg HB, Wyatt RG, Flores J, Sereno MM, Kapikian AZ, Chanock RM: Genes of human (strain Wa) and bovine (strain UK) rotaviruses that code for neutralization and subgroup antigens...

Ngày tải lên: 12/08/2014, 04:20

6 220 0
Báo cáo sinh học: "Rapid PCR detection of group a streptococcus from flocked throat swabs: A retrospective clinical study" ppsx

Báo cáo sinh học: "Rapid PCR detection of group a streptococcus from flocked throat swabs: A retrospective clinical study" ppsx

... (GAS) dnaseB assay dnaseB forward primer TGA TTC CAA GAG CTG TCG TG dnaseB reverse primer TGG TGT AGC CAT TAG CTG TGT T IAC TGATTCCAAGAGCTGTCGTGatcaatataacaaacacttgcatatatatact tacgaaactaataactaaataatcaatataaatACACAGCTAATGGCTACACCA ... tacgaaactaataactaaataatcaatataaatACACAGCTAATGGCTACACCA Slinger et al Annals of Clinical Microbiology and Antimicrobials 2011, 10:33 http://www.ann-clinmicrob.com/content/10/1/33 then heated at 100°C ... design and data collection and analysis DR and IM participated in the performance of the PCR assay and data analysis All authors contributed to the preparation of the manuscript All authors read and...

Ngày tải lên: 12/08/2014, 17:20

5 320 1
Báo cáo y học: "Decreased levels of dehydroepiandrosterone sulphate in severe critical illness: a sign of exhausted adrenal reserve" pdf

Báo cáo y học: "Decreased levels of dehydroepiandrosterone sulphate in severe critical illness: a sign of exhausted adrenal reserve" pdf

... theoretically, beneficial Key messages • Critically ill patients exhibit a remarkable depletion in DHEAS in both acute and chronic phases, suggesting an exhausted adrenal adaptation • There is a clear ... using a statistical software package (SPSS 9.0.1; SPSS Inc, Chicago, IL, USA) Results The clinical and laboratory characteristics of the patients and control groups on admission are summarized ... 2.2 Values are means ± SD ACTH, adrenocorticotrophic hormone; APACHE, Acute Physiology and Chronic Health Evaluation; DHEAS, dehydroepiandrosterone sulphate; SOFA, Sequential Organ Failure Assessment;...

Ngày tải lên: 12/08/2014, 18:21

5 200 0
Báo cáo khoa học: "Cerebral perfusion pressure and risk of brain hypoxia in severe head injury: a prospective observational study" ppt

Báo cáo khoa học: "Cerebral perfusion pressure and risk of brain hypoxia in severe head injury: a prospective observational study" ppt

... [http://www2.braintrauma.org/guidelines/ downloadbtf_guidelines_management.pdf?BrainTrauma_Session = 2a6 642d5eb4eaaf3c01adc3262 3a5 1] van den Brink WA, van Santbrink H, Steyerberg WW, Avezaat CJ, Suazo JA, ... were male The causal mechanism was road traffic accident in fifteen cases, fall in six cases and aggression in one case The median post-resuscitation Glasgow Coma Score was The mean APACHE II ... Health Evaluation (APACHE) II score, the Revised Trauma Score for triage (T-RTS) and the Injury Severity Score (ISS) The Traumatic Coma Databank computed tomography (CT) scan classification was...

Ngày tải lên: 12/08/2014, 23:20

7 254 0
Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

... of randomization) and daily through to study day A central laboratory (Covance Central Laboratory Services, Indianapolis, IN, USA) performed all assays The PC activity assay was performed on a ... STA® coagulation analyzer using the STA®- Staclot® Protein S kit (Diagnostica Stago) Antithrombin III activity was quantitated using a chromogenic activity assay (Stachrome ATIII; Diagnostica ... median values, analysis was based on median value PROWESS, Recombinant Human Activated Protein C Worldwide Evaluation in Severe Sepsis; SD, standard deviation; SOFA, Sequential Organ Failure Assessment...

Ngày tải lên: 13/08/2014, 08:21

11 343 0
Báo cáo y học: "Early down-regulation of the pro-inflammatory potential of monocytes is correlated to organ dysfunction in patients after severe multiple injury: a cohort study" pptx

Báo cáo y học: "Early down-regulation of the pro-inflammatory potential of monocytes is correlated to organ dysfunction in patients after severe multiple injury: a cohort study" pptx

... Gerlach H: Early detection of increased tumour necrosis factor alpha (TNFalpha) and soluble TNF receptor protein plasma levels after trauma reveals associations with the clinical course Acta Anaesthesiol ... Orfanos S, Kotanidou A, Livaditi O, GiamarellosBourboulis E, Athanasiou C, Korovesi I, Sotiropoulou C, Kopterides P, Ilias I, Kanellakopoulou K, Armaganidis A: Plasma proand anti-inflammatory cytokine ... cellular origin Thus, an adequate evaluation of the inflammatory balance is more complex than just measuring cytokine concentrations in body fluids, requiring appropriate methodical approaches In Available...

Ngày tải lên: 13/08/2014, 16:21

11 301 0
w