separation membranes from chitin and chitosan derivatives

... wetland plants to translocate oxygen to support a wide range of bacteria in the wetlands is shown in Figure Wetlands can be of two types: natural wetlands and constructed wetlands Both natural and ... of Constructed Wetlands Constructed wetlands are relatively recent development, and are gaining popularity for treatment of wastewater from small communities, and residential and commercial areas ... REFERENCES Mitsch, W.J and J.G Gosselink, Wetlands, Van Nostrand and Reinhold Company, New York, 1993 Reed, S.C., E.J Middlebrooks, and R.W Crites, Natural Systems for Waste Management and Treatment,...

Ngày tải lên: 10/08/2014, 20:20

... second-line and subsequent therapies were taken from a study that investigated the optimal sequence of FOLFOX and FOLFIRI as first- and second-line therapies, and were applied equally to treatment and ... 37% of overall survival Resource use and costs were taken from the RCT as reported in the manufacturer’s submission and augmented from the published literature and personal communication with clinical ... NHS practice in England and Wales 4.3.5 The Committee then considered the estimates of cost effectiveness of bevacizumab It noted that the models from the manufacturer and from the assessment...

Ngày tải lên: 14/02/2014, 22:20

... HA in the temporomandibular joint reduced levels of prostaglandin F2α, 6-keto-prostaglandin F1α, and leukotriene C4 [72] In synovial fluid from the knees of patients with OA and RA, intra-articular ... cartilage [36] Both IL-1β and TNF-α stimulate their own production and the production of other cytokines (e.g IL-8, IL-6, and leukotriene inhibitory factor), proteases, and prostaglandin E2 (PGE2) [30] ... cells from an OA patient; various MWs and doses of HA Synovial fluid of patients with knee-joint effusion before and after injection of HA Synovial fluid collected from OA patients before and after...

Ngày tải lên: 09/08/2014, 01:21

... nickel, and cobalt Other bacteria produce complexing agents which selectively extract metals from dilute solutions Algae concentrate silica and green-brown algae and fungi concentrate zinc and other ... microorganisms and processes for destruction of organic toxics and hazardous materials heretofore immune to treatment and to shorten process and retention time The need is present in the market place and ... extracted from soil and water bodies and more recently technically developed for specific applications, and uses organic and toxic materials as sources of energy and carbon While in the future, biological...

Ngày tải lên: 16/03/2014, 18:11

... nickel, and cobalt Other bacteria produce complexing agents which selectively extract metals from dilute solutions Algae concentrate silica and green-brown algae and fungi concentrate zinc and other ... microorganisms and processes for destruction of organic toxics and hazardous materials heretofore immune to treatment and to shorten process and retention time The need is present in the market place and ... extracted from soil and water bodies and more recently technically developed for specific applications, and uses organic and toxic materials as sources of energy and carbon While in the future, biological...

Ngày tải lên: 16/03/2014, 18:11

... concepts and arguments come from major resources like books, journals and professional association websites relative to business and marketing management 1.4 Research approach, methodologies and empirical ... Fluctuating demand – The demand for business goods and services tends to be more volatile A percentage increase in customer demand can lead to a far larger percentage rise in business demand  Geographically ... successful rivals and improve on them, avoid and overcome unsuccessful players‘ pitfalls Figure 10 below shows how to learn from rivals inside and outside the industry 37 FIGURE 10 Learning from competitors...

Ngày tải lên: 23/07/2014, 03:36

... DOMESTIC AND SPECIAL APPLICATIONS In recent years natural systems are also used for wastewater treatment from small establishments and sub-divisions Among these are land treatment, and natural and ... recovered from the dehumidifier condensate, hygiene uses, and in the future, from urine Also the removal of trace contaminants from the air, the maintenance of the air composition and pressure, and ... effect and suppress fecal odors Most commonly used chemicals are: (1) halogens and their compounds, (2) coal-tar distillate (phenols and cresols), (3) heavy metals and their salts (zinc, copper and...

Ngày tải lên: 10/08/2014, 20:20

... DEMAND, AND RESIDUAL Chlorine is a powerful oxidizer that is commonly used in wastewater and water treatment for disinfection and in wastewater treatment for odor control, bulking control, and ... food and oxygen, they produce more organisms, carbon dioxide, sulfates, nitrates, and other stable byproducts; these materials are then discarded from the slime back into the wastewater flow and ... 400 lb/day Chlorine Demand The chlorine demand is the amount of chlorine used to react with various components of the water such as harmful organisms and other organic and inorganic substances...

Ngày tải lên: 11/08/2014, 13:22

... suspended solids and volatile suspended solids, and biosolids volume and biosolids density indexes (Note: Water/wastewater labs usually determine chlorine residual and perform other standard solution ... concentration, pH, chemical oxygen demand (COD), total phosphorus, fecal coliform count, chlorine residual, and biochemical oxygen demand (BOD) seeded tests, to name a few The standard reference for performing ... Solids, and Volatile Solids Wastewater Suspended Solids and Volatile Suspended Solids Biosolids Volume Index (BVI) and Biosolids Density Index (BDI) WATER/WASTEWATER LAB Ideally, waterworks and wastewater...

Ngày tải lên: 11/08/2014, 13:22

... tank is 20 ft wide by 50 ft long and contains water to a depth of 16 ft? CHANNEL AND PIPELINE CAPACITY CALCULATIONS A rectangular channel is 340 ft long, ft deep, and ft wide What is the volume ... 70 ft and a depth of 19 ft What is the volume of water in the tank (in gallons)? 24 If a tank is 25 ft in diameter and 30 ft deep, how many gallons of water will it hold? FLOW, VELOCITY, AND CONVERSION ... chlorine demand is 8.8 mg/L and a chlorine residual of mg/L is desired? 64 A total chlorine dosage of 10 mg/L is required to treat the water in a unit process If the flow is 1.8 MGD and the hypochlorite...

Ngày tải lên: 11/08/2014, 13:22

... third”, “fourteen and two thirds”, “six and five sevenths”, “forty three and one half”, and “twenty three and twelve thirty fifths” Changing a fraction: Multiplying the numerator and the denominator ... example, 23.676 is read “twenty-three and six hundred seventy-six thousandths,” and 73.2658 is read “seventy-three and two thousand six hundred fifty-eight ten-thousandths.” Example 3.3 Problems Reduce ... root, adding and subtracting, converting decimals to fractions, and other math operations using nothing more than pencil and paper and brain power Eventually, this same person is handed a pocket...

Ngày tải lên: 11/08/2014, 13:22

... treatment systems that can highly and simultaneously remove nitrogen and phosphorus from wastewater Among those, biological nutrient removal processes, such as suspended and attached growth biofilm techniques, ... have lower operating and maintenance costs, and eliminate the need for additional, frequent, and expensive chemical use (Markus et al., 2011; Wahab et al., 2011; Oleszkiewicz and Barnard, 2006; ... remove organics, nitrogen, and phosphorus with respect to the nitrogen and phosphorus loading rate as a function of operation time or hydraulic residence times; and biological and non-biological phosphorus...

Ngày tải lên: 13/09/2015, 17:48

... GOT, and GPT were measured using routine laboratory protocols SUBJECTS AND METHODS RNA preparation and RT-PCR Study design This study was an open clinical trial Adult CF patients were recruited from ... centrifugation over Ficoll-Paque (Pharmacia, Uppsala, Sweden) and washed Sputum cell and PBMC samples, each containing RNAzol (Wak, Bad Soden, Germany) and 80,000 cells, were stored at -20ºC until further ... alone and combined therapy significantly decreased TNFα mRNA expression in sputum cells (1.31 ± 0.53 pre vs 0.54 ± 0.0 post and 0.94 ± 0.39 pre vs 0.31 ± 0.13 post) (P < 0.05) (Figure A) and in...

Ngày tải lên: 03/11/2012, 11:48

... #!!(),)## 1.23452/0267/8 '"# Figure Band intensities for Nitrobacter species While in Figure 4, the band intensities were high only in Runs and 7, and their band intensities were quite similar, ... with PCR and FISH By both of PCR and FISH analyses, only Nitrobacter species were detected The PCR result with FGPS primer set is shown in Figure The band intensitis were quantified, and were ... CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r...

Ngày tải lên: 05/09/2013, 09:38

... (2008ZX07103-001 and 2008ZX07316-002), and the Anhui R&D Key Project (07010301022 and 08010302109) for the partial support of this study REFERENCES Standard Methods for the Examination of Water and Wastewater ... d, h and 30 min, respectively; in Series III, the HRT of the adsorption tank was lowered stepwise from 30 to 10 min, while the SRT, HRT of the regeneration tank, and R were kept at d, h and 40%, ... sludge solution, and spiked with wastewater They were immediately sealed with rubber plugs and were shaken on a thermostatic rotary shaker at 125 rpm and 20°C Samples were collected from the flasks...

Ngày tải lên: 05/09/2013, 09:38

... construction and operation phase and from use of electricity; local environmental impact from extraction of raw material used in machinery and buildings - 284 - Journal of Water and Environment ... (rainwater, drilled well water, and hand-dug well water) for cooking, drinking and domestic purposes However, the numbers of hand-dug wells in use are reducing gradually and mainly poor households ... according to the survey’s results, drilled well water and hand-dug well water have a fishy smell, and will turn yellow and taste salty if left standing for a few minutes Concerning sanitation, the...

Ngày tải lên: 05/09/2013, 10:15

... treatment plant with an activated sludge process (Jokaso), from rain water, and from Tedori River (Tedori Bridge), Unoke River (Konan Bridge) and Lake Tedori; deionized water in the laboratory was ... treatment plant effluent (10 mg/L), and rain water (5 and 10 mg/L) More than 20% degradation was observed in all Lake Tedori water and Unoke River water samples and rain water sample (1 mg/L) 100 ... samples (1, 5, and 10 mg/L), all deionized water samples, and Unoke River water samples (5 and 10 mg/L), after d of incubation However, the density decreased in all rain water samples and the Unoke...

Ngày tải lên: 05/09/2013, 10:15

... management and pollution controls Contamination of raw water source Implement and enforce water and land protection zones Water stress/ insufficient water allocation Study water yields; draft and conclude ... include blower and oxidation ditch, pump and trickling filter, and clarifier Based on the literature review, specifications, operating time, and capacity, it was estimated that blower and oxidation ... efficiency and renewable investments Conclusions and future work This research evaluates the relationship between environmental and energy factors and explores the value in tracking energy and environmental...

Ngày tải lên: 05/09/2013, 15:28