self benchmarking in maintenance of a chemical plant

... with increasing intensity, indicating formation of imidazole-bound heme–GmHO-1 (data not shown) The association constant was estimated on the basis of the changes in absorbance at 402 nm (imidazole-free ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... degradation rate of GmHO-1, indicated in Table 4, is comparable to that of SynHO-1 in the presence of NADPH, FNR, and Fd, and also to that of rHO-1 in the presence of NADPH and CPR Here, NADPH...

Ngày tải lên: 19/02/2014, 05:20

... light; VAZ, violaxanthin, antheraxanthin and zeaxanthin Chl b Neoxanthin Violaxanthin Antheraxanthin Lutein Zeaxanthin b-Carotene VAZ 19.4 20.5 19.3 31.0 Zb63 CL Zb63 LL Zb63 HL WT CL Tot Car 50.4 ... maximum standard deviations determined were for neoxanthin and antheraxanthin, for violaxanthin, zeaxanthin and b-carotene, for lutein and Chl b, and for total carotenoid content (Tot Car) LL, ... b-branch of the biosynthetic pathway (VAZ, violaxanthin, antheraxanthin and zeaxanthin) increased with illumination intensity Thus, carotenoid composition in the mutant is modified following the...

Ngày tải lên: 30/03/2014, 10:20

... TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG ... AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ATCAACTACTTTGTGAG TCCATGATATGATTGATATGC GTGGCAATGGTAATCCAC Site-directed ... mutagenesis GCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG GGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC GTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC CATATGTAGATGGAGCTGGAACTGTCCCTG GGAGTGTCACTTAATGCACCCTTTGATGTTTG...

Ngày tải lên: 30/03/2014, 15:20

... revisiting underlying assumptions and providing alternative explanations (summarised in Table 1) for observations advanced - Page of 20 and maintained - as key by advocates of the hypothesis, adding ... mouse models that the paracrine c-kit/SCF signaling pathway is crucial for activation of primordial follicles, oocyte survival and growth, and maintenance of meiotic arrest in small antral follicles ... follicular cells leading to failure of tolerance, induction of autoimmunity against ovarian antigens, and subsequent destruction of surviving follicles; and (C) after BMT and establishment of haematopoietic...

Ngày tải lên: 20/06/2014, 07:20

... Breit-Wigner peak centered at the bonding molecular state and an asymmetrical Fano line shape centered at the antibonding molecular state The degree of the asymmetry of the Fano-Like peak can be attributed ... molecular junction can be realized by using a twodimensional electron gas below the surface of an AlGaAs/GaAs heterostructure [1] The RSOI in the QD can be introduced by using an asymmetrical-interface ... Spin-polarized current and spin accumulation in a three-terminal two quantum dots ring Appl Phys Lett 2008, 92:172104-172106 41 Uchida K, Takahashi S, Harii K, Ieda J, Koshibae W, Ando K, Maekawa...

Ngày tải lên: 20/06/2014, 23:20

... dependence of the decay time obtained by fitting the PL decay profile to a single exponential function With increasing temperature from 80 K to 170 K, a linear increase of the radiative decay time occurs ... the QD transition energies in our samples Conclusion In conclusion, we have measured the rise and decay dynamics of the ground and first excited state of InAs QDs capped with an InGaAs quantum well ... have found that the higher energy states of the QDs don’t act as intermediate stages in the carrier relaxation, while the carriers can cool down to any lower energy states following a relaxation...

Ngày tải lên: 22/06/2014, 18:20

Ngày tải lên: 05/08/2014, 10:20

... Other Abies alba Fagus sylvatica 57 45 Fagus sylvatica and other broadleaves Abies alba 456 12 102 93 147 410 Abies alba Fagus sylvatica and other broadleaves Abies alba Fagus sylvatica and other ... other broadleaves Acer pseudoplatanus 75 85 Acer pseudoplatanus 60 Fagus sylvatica and other broadleaves Abies alba 10 Acer pseudoplatanus 80 63 Abies alba Living trees (trees/ha) Abies alba Fagus ... that of fir had decreased (Table 2), and that beech proportion in increment was greater than it proportion in basal area and stand volume (Tables and 4) According to studies of Priesol and Hladík...

Ngày tải lên: 07/08/2014, 03:22

... probably intercepting enough light or had an aboveaverage leaf area/basal area ratio Vincke et al [27] found that Radial sap flow in beech trunks SFD variability was larger in a thinned than in an ... [1,2,4,17] Diurnal values of transpiration of individual trees are then a stratified random sample, the transpiration in mm being calculated from them via the basal area of the stand [5] This procedure, ... on radial patterns of sap flux density of a 70-year Fagus crenata trees in the Naeba Mountains, Japan, Ann For Sci 62 (2005) 289−296 [25] Phillips N., Oren R., Zimmermann R., Radial patterns of...

Ngày tải lên: 07/08/2014, 16:21

... 1.5 years) and 0.44 QALYs if started after years from the diagnosis [9] These data clearly demonstrate that an early diagnosis of ILD in SSc is fundamental for starting a treatment that may ameliorate ... associated with a greater preservation of lung function and that it allowed a gain of 0.20 qualityadjusted life years (QALYs) versus a loss of 0.21 QALYs of the case base (disease duration of 1.5 ... withdrawals in the active group due to side effects (1 patient had intolerable nausea and patient had abnormal findings on liver function tests during treatment with AZA) and no withdrawals in the...

Ngày tải lên: 09/08/2014, 01:22

... out a myofibromatosis that has been documented at this site and in similar aged patients [7] Infact, the present case was initially reported as myofibromatosis at another laboratory Variable SMA ... neck, associated with episodes of pain and swelling in his throat, since birth One of the episodes was severe that led to acute dyspnoea and dysphagia that was clinicoradiologically diagnosed as a ... surgical excision Increasing size, risk of coagulopathy are indicators for therapeutic interventions in such cases Medical treatment is included in cases associated with KMP [13] KMP was lacking in...

Ngày tải lên: 09/08/2014, 01:24

... 100 %a 100%b A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/79/2003(H2N3) ... mice and replicate and transmit in ferrets without causing substantial morbidity and with no mortality An outbreak of avian influenza in 2004 in British Columbia, Canada, included LPAI and HPAI ... identify and characterize viral determinants of virulence and transmission of avian influenza viruses in mammals Materials and methods Viruses and cells The A/ Mallard/Alberta/24/01 (H7N3) (Mal/01), A/ ...

Ngày tải lên: 12/08/2014, 04:21

... NY, USA) using the following primers: forward 5'GAAGATCTATGCCCAAGAAGAAGAGGAAGGTGTCCAATTTACTGAC-3' and reverse 5'-CGGAATTCTGAACAAACGACCCAAC-3' The PCR product was then sub-cloned into the BamHI-EcoRI ... collagen deposition around the walls of small veins and terminal respiratory bronchioles and in certain parenchymal areas (Fig 3A~ j arrowheads) In contrast, there is only minimal βgal staining ... βgal staining was observed in the sub-epithelial areas of small and medium bronchi, respectively (arrowheads in b, d, g) The βgal stained areas of bronchus (d, g) paralleled the staining pattern...

Ngày tải lên: 12/08/2014, 16:20

... indicates an interaction between spatial and temporal variability The temporal variability mainly consisted in seasonal cycles and in the eect of clear-cutting (decrease in concentrations and disappearance ... samplers A hierarchy between the samplers was also observed, and appeared to be partly modied after the clear-cutting, indicating again that the treatment induced some interaction between spatial and ... (Microsoft) and Unistat software applications Data processing was carried out in several stages, using ANOVA test on every single measurement, before and after the clear-cutting (test of Student-Newman-Keuls),...

Ngày tải lên: 07/08/2014, 16:20

... that some of these phenomena may be interconnected within the catalytic mechanism of the enzyme Structural insights into the mechanochemical nature of a- CT catalysis A more detailed analysis of ... enzymatic catalysis from both an experimental and theoretical perspective Changes in the kinetics of a- CT catalysis upon chemical glycosylation The catalytic behavior of a- CT after chemical glycosylation ... Sola and K Griebenow Structural dynamics and serine protease catalysis Table Global energetic parameters and DebyeWaller temperature factors calculated for the protein portion of a- CT and the various...

Ngày tải lên: 19/02/2014, 05:20

... kit (Amersham Biosciences, Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal ... et al naya OA, Kolpakov FA et al (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara...

Ngày tải lên: 19/02/2014, 06:20

... (forward, 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACA GGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco (forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢; reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulinspecific ... plants, the average starting quantity of AtZFP11 was normalized to the average starting quantity of the a- tubulin gene, which is assumed to be at a constant levels in all the samples The Arabidopsis ... collected at 0.2 °C intervals The starting amount of the AtZFP11 transcript in each sample was calculated using a standard curve (logarithm of the starting quantity versus threshold cycle) generated...

Ngày tải lên: 16/03/2014, 06:20

... 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ ... 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ ... 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ 5¢-GACTAGAAGCGGGAACGCCATACGGA-3¢...

Ngày tải lên: 17/03/2014, 10:20

... molecular dynamics (SMD) simulations have shown that for I27 rupture of a pair of hydrogen bonds in the A and B b-strands near the amino terminus of the protein domain causes an initial extension of ... experimental control allows statistical examination of the unfolding and folding pathways of a protein[38–42] and a chemical reaction[43] in the solvent environment of interest Perturbing the equilibrium ... result of a delicate balance between intramolecular and hydration interactions, D2O may alter the dynamics of protein function in subtle and non-intuitive ways.[32–35] Interestingly, in contrast...

Ngày tải lên: 22/03/2014, 18:20

... replacement of a Pro with an Ala maintained or decreased the antimicrobial activity but significantly increased the hemolytic activity In addition, Oh et al [38] reported that a cecropin A magainin ... antimicrobial activity The antimicrobial activity of peptides against a range of micro-organisms was determined by broth microdilution assay Briefly, a single colony of bacteria was inoculated into ... other Central proline in amphipathic a- helix amphipathic a- helical peptides such as magainin [52,53], the initial binding of M17P (K1 ¼ 6.8 · 104 m)1) was much faster than the following insertion...

Ngày tải lên: 23/03/2014, 10:21