selection of vhh antibody fragments that recognize different a b depositions using complex immune libraries

Báo cáo sinh học: " Application of a haematopoetic progenitor cell-targeted adeno-associated viral (AAV) vector established by selection of an AAV random peptide library on a leukaemia cell line" pot

Ngày tải lên : 14/08/2014, 19:22

... using Figure of and standard + rAAV capsid mutant an MOI Gene transfer efficiency of the rAAV capsid mutant (EARVRPP; ) and a standard rAAV2-based vector (ᮀ) on primary human CML and CD34+ PBPC ... transduction by recombinant adeno-associated virus vectors J Virol 1996, 70:3227-3234 Kashiwakura Y, Tamayose K, Iwabuchi K, Hirai Y, Shimada T, Matsumoto K, Nakamura T, Watanabe M, Oshimi K, Daida H: ... titration of rAAV2 batches All rAAV2 stocks were titrated using both a functional and a RQ-PCR titration method, as described previously by Veldwijk et al [25] For titration of the AAV2 random peptide...

9
328
0

Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"

Ngày tải lên : 25/10/2012, 11:04

... frontal sinus aplasia was defined as the absence of frontal bone pneumatization with no ethmoid cells extending above a line tangential to the supraorbital margin Frontal sinus aplasia was also ... Unilateral absence of the frontal sinus; on the left, the absence of frontal sinus; axial view (A) , coronal view (B) , and sagittal view (C) The frequency of bilateral and unilateral agenesis of the ... Development and Anatomy of the Nose, Paranasal Sinuses, Nasolacrimal Passageways and Olfactory Organs in Man Philadelphia: P Blakiston’s Son; 1920 Som PM, cCurtin HD Head and neck imaging In: Som...

5
577
0

Tài liệu Evaluation of physical activity programmes for elderly people - a descriptive study using the EFQM’ criteria ppt

Ngày tải lên : 14/02/2014, 06:20

... made available by some of the coordinators Other information was gathered from the web page of the organization We used standard approaches to statistical analysis of data including frequencies and ... information: geographic localization, name and objectives of PA programmes, age of the PA programme, characteristics of age groups and participants’ age, number of activities included in the PA programme, ... the use of a management methodology based on objective criteria that is applicable to all areas of business and constitutes a self-assessment exercise of the organization’s quality Self-assessment...

16
959
0

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a speciﬁc ternary complex with tRNASer potx

Ngày tải lên : 23/03/2014, 09:20

... were separated on a 9% SDS ⁄ PAGE gel, transferred to nitrocellulose membrane, and immunoblotted with rabbit anti-LexA (Invitrogen, Carlsbad, CA, USA) and rabbit anti-SerRS raised against yeast SerRS ... Halobacterium salinarum; MT, Methanothermobacter thermautotrophicus; HS, Homo sapiens; BS, Bos taurus; MM, Mus musculus; GG, Gallus gallus; AT, Arabidopsis thaliana; ZM, Z mays; CA, Candida albicans; ... migration of the protein binary complex (Fig 2A, lane 5), suggesting that ternary complex formation was speciﬁc for tRNASer The formation of binary and ternary complexes was assayed under various...

12
406
0

báo cáo hóa học: " Use of alcohol and drugs by Norwegian employees: a pilot study using questionnaires and analysis of oral fluid" doc

Ngày tải lên : 20/06/2014, 00:20

... alcohol and drugs, and can to some extent be a substitute for blood samples; oral fluid is probably the only other easily available body fluid that might parallel blood in some regards and may ... metabolite of heroin, only illegal use in Norway 0.41 7-aminoclonazepam Degradation product and metabolite of clonazepam 0.36 7-aminoflunitrazepam Degradation product and metabolite of flunitrazepam ... Meprobamate Metabolite of carisoprodol 10.9 Morphine Opiate analgesic Also metabolite of codeine and heroin 3.6 Nitrazepam Benzodiazepine; hypnotic 0.21 Nordiazepam Psychoactive metabolite of diazepam...

8
418
0

Báo cáo toán học: "The Structure of Maximum Subsets of {1, . . . , n} with No Solutions to a + b = kc" potx

Ngày tải lên : 07/08/2014, 08:22

... have seen so far that any k-sum-free set A can be turned into a k-sum-free set At having overall size at least |A| The set At is a union of intervals, as given by (1), though note that the ﬁnal ... ﬁnd that (k − 2)w |B| = |A ∩ [1, w]| ≤ |B ∩ [1, r2 ,B ]| + (4) k But sB = sA implies that r2 ,B ≤ r2 ,A , hence that B ∩ [1, r2 ,B ] ⊆ A ∩ [1, r2 ,A ] Thus (3) and (4) yield the inequality |A| ≤ |A ... To obtain the structural result we consider the successive transformation of an arbitrary k-sum-free set A into a set At of intervals as in (1) Our plan is to show that each member of the transformation...

16
268
0

báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

Ngày tải lên : 12/08/2014, 03:20

... PEAMT-For5'TTGCCCTTGAG CGTTCTATT, Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, ... Ishikawa H, Baba S, Takabe T, Wada K, Ishii T: Molecular cloning and functional characterization of two kinds of betaine-aldehyde dehydrogenase in betaine-accumulating mangrove Avicennia marina (Forsk.) ... tolerance of Dunaliella salina, a unicellular alga, to nearly saturating NaCl concentration, nonetheless, has been suggested to be in part due to increased accumulation of a halophilic plasma membrane...

25
292
0

Báo cáo khoa học: Identiﬁcation and characterization of four novel peptide motifs that recognize distinct regions of the transcription factor CP2 doc

Ngày tải lên : 16/03/2014, 18:20

... (5¢-GAAACCATTTTGCAGCGAAAGTATACAC-3¢) for Pro ⁄ Arg to Ala ⁄ Ala mutations in bases 803–830 The two overlapping PCR fragments were mixed and added as a template in the second PCR that used 1–19 and ... motifs of pcDNA-FLAG)12-mer peptide vector: 5¢-CGGAATTC CCCCCAAAAAAGAAGAGAAAGAT-3¢ and 5¢-GGGG TACCCCGTCTTCTATCTTTCTCTTCTTT-3¢ The REST cDNA fragment was generated by PCR from the pcDNAFLAG–REST ... triplicate Speciﬁc binding to CP2 was obtained by subtracting the absorbance value of background GST binding from that of GST–CP2 binding The results are presented as mean ± standard error (C) CP2-binding...

13
451
0

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

11
679
0

Báo cáo khoa học: "What is the Minimal Set of Fragments that Achieves Maximal Parse Accuracy?" potx

Ngày tải lên : 23/03/2014, 19:20

... probability of a subtree t as the probability of selecting t among all corpus subtrees that can be substituted on the same node as t This probability is equal to the number of occurrences of ... subtrees that are seen in a treebank, a markov grammar assigns probabilities to any possible rule, resulting in a more robust model We expect that the application of the markov grammar approach to ... (eds.), Advances in Probabilistic and Other Parsing Technologies, Kluwer Academic Publishers E Charniak, 1996 Tree-bank Grammars, Proceedings AAAI'96, Menlo Park, Ca E Charniak, 1997 Statistical Parsing...

8
302
0

Báo cáo khoa học: Epitope analysis of the rat dipeptidyl peptidase IV monoclonal antibody 6A3 that blocks pericellular ﬁbronectin-mediated cancer cell adhesion pot

Ngày tải lên : 29/03/2014, 22:21

... (Santa Cruz, CA, USA); human FN pAb from rabbit was from Sigma (St Louis, MO, USA); rabbit polyclonal anti-MBP serum and amylase agarose beads were from New England Biolabs Inc (Ipswich, MA, ... Hung et al Epitope of monoclonal DPP IV antibody A Fig 6A3 -recognizable DPP IV fragments block the bindings of 6A3 to both native and denatured full-length DPP IV (A) FACS analyses of ectopically ... Clin Cancer Res 7, 2031–2040 15 Inamoto T, Yamada T, Ohnuma K, Kina S, Takahashi N, Yamochi T, Inamoto S, Katsuoka Y, Hosono O, Tanaka H et al (2007) Humanized anti-CD26 monoclonal antibody as a...

12
410
0

Báo cáo y học: "“I could cry, the amount of shoes I can’t get into": A qualitative exploration of the factors that influence retail footwear selection in women with rheumatoid arthritis" pdf

Ngày tải lên : 10/08/2014, 21:24

... and quality of life Results Demographic details of participants are outlined in Table illustrating a varied range of participants each with different ages, lifestyles and duration of disease activity ... limiting factors on everyday footwear selection Aesthetic Appearance and Design of Footwear The aesthetic appearance and design of the footwear were described by all participants in various categories ... women with RA and six key areas of importance have been described In particular, loss of choice due to aesthetic appearance and design of retail footwear, body image and psychosocial aspects surrounding...

8
429
0

báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt

Ngày tải lên : 12/08/2014, 03:21

... Because neither the NCBI database nor any single EST assembly contained sequences that matched all of the Butte 86 gamma gliadins, specialized databases that included the Butte 86 sequences were ... VLQTLPTMRNMYVPPY [GenBank: ACJ03516.1] Aegilops searsii IV Qi et al [20] LAQIPQQLQYAAIHS [GenBank: ACI04088.1] [GenBank: AAK84776.1] [GenBank: ACJ03499.1] [GenBank: CAI78902.1] [GenBank: ACI04102.1] T aestivum ... compositional adjustment, no filters, no masks, database last searched on 7/22/09 Altenbach et al BMC Plant Biology 2010, 10:7 http://www.biomedcentral.com/1471-2229/10/7 Page of 14 Table Butte 86 gamma...

14
325
0

Báo cáo y học: "Reduced efficacy of selection in regions of the Drosophila genome that lack crossing over" doc

Ngày tải lên : 14/08/2014, 17:22

... http://genomebiology.com/2007/8/2/R18 Additional data files The following additional data files are available with the online version of this article Additional data file contains information on mean values of GC content and ... samples that represent only a small fraction of genes found in the Drosophila genome, which may also be biased toward genes that are known to be rapidly evolving, so that the results may not be ... in all cases) Because there has been some suggestion that comparisons of estimates of dS from PAML can be misleading when there are large differences in codon usage bias among genes [21], we also...

9
247
0

RESEARCH ON THE GENETIC DIVERSITY OF SOME SOYBEAN VARIETIES THAT ARE RESISTANT TO RUST DISEASE IN DIFFERENT WAYS

Ngày tải lên : 20/04/2016, 10:05

... to 0.95 Brand II Sub brand II Sub brand I Sub brand II Brand I Sub brand I Figure 3.5 Tree diagram of the relationship of 50 soybean varieties have different reactions to rust disease based on ... Soybean and biochemistry of soybean 1.1.1 Soybean Soybean (Glycine max (L.) Merrill) is a plant of the legume (Fabaceae) The branch of Glycine has two sub-branches such as Glycine and Soja Originally, ... established a tree diagram of the 50 soybean varieties (Figure 3.3) The result showed that 50 soybean varieties distributed into major branches (Branch I and Branch II) Branch I has only VK2 and...

27
317
0

KếT QUả BƯớC ĐầU TUYểN CHọN GIốNG XOàI ĐịA PHƯƠNG TạI HUYệN YÊN CHÂU, TỉNH SƠN LA Initial Results on Clone Selection of Local Mangoes Grown in

Ngày tải lên : 28/08/2013, 10:23

... Châu, tỉnh Sơn La Tạp chí Khoa học v phát triển, Trờng Đại học Nông nghiệp H Nội, tập VI số 2, tr 105-109 Rechard E.L (2000) The Mango: botany, production and uses CAB International Pp 545-565 ... đợt lạnh Khoảng thời gian ny l thời gian hoa rộ đợt hoa vụ nên tất hoa xoi đợt b h hại rét, chí nụ hoa b thui đen, không kịp nở Năng suất thu đợc xoi l nhờ vo đợt hoa thứ hai xuất vo tháng nhiệt ... trờn Gn súng Xanh nht Xanh m 3,69 Gn súng Xanh nht Xanh m 5,56 4,13 Gn súng Xanh vng Xanh nht 21,05 5,71 4,26 Gn súng Xanh vng xanh 8,9 27,92 6,76 4,20 Phng, gõn ni Xanh vng Xanh Hỡnh chúp 11,0 24,96...

6
496
1

Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

Ngày tải lên : 05/09/2013, 10:15

... (suspended biomass) to form aerobic granular sludge for all the experiments was obtained from an aerobic basin of a municipal wastewater treatment plant (Tokyo, Japan) Table - Wastewater composition ... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular ... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8...

8
481
0

Tài liệu THE CRAFT OF WRITING SCIENCE FICTION THAT SELLS pptx

Ngày tải lên : 19/01/2014, 20:20

... they will balk at such a name and stop reading The break may be only momentary, but any break in reading a story can be fatal Maps are a good place to find strange names, provided you are careful ... people and not about inanimate objects, no matter how fascinating they may be A story is about people; take out the people and you have a travelogue, at best Of course, a good writer can break that ... Thus, Burroughs created the exotic Barsoom of John Carter, master swordsman; Weinbaum created the desert world populated by strangely nonhuman Martians; and Bradbury created a fantasy world of bone-chess...

141
522
0

Create pictures worth framing with this selection of tips 3

Ngày tải lên : 27/01/2014, 16:09

... your camera very steady is the key in shooting images that are crisp and very sharp Many cameras have an automatic stabilizer built right into it to allow for some leeway If you are still having ... out too bright Some cameras have an automatic flash setting so that your camera knows when the flash is needed Many cameras allow you to set the white balance This setting tells the camera which ... easier to produce quality photos Do not use the flash on a camera unless you are in a darker location Using a flash outdoors in a location that already has a lot of light will just make your picture...

3
238
0

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Ngày tải lên : 19/02/2014, 08:20

... GST-ExoS(D42 7A) 17 GST-ExoS(L42 8A) 18 GST-ExoS(LD426–427AA) Amersham S419QGLLDALDL428 M419AAAA428 S419QGLLDAAAA428 S419QGLLAAAAA428 S419QGLLAALAL428 I419QGLLDALDL428 S419AGLLDALDL428 S419QALLDALDL428 ... evolution has created a new way to take advantage of an evolutionary ‘novel’ eukaryotic 14-3-3 protein family, using them as a necessary cofactor to activate lethal bacterial toxins, 644 but only after ... from bacteria and transferred to a new Petri dish and incubated overnight with medium containing gentamicin Bacterial growth of each strain was assessed by viable counts, both during initial infection...

9
525
0