selecting for genes with standard deviation gt 0 7

... (5'→3') 0. 9 97 2 .05 GGCAAATTCAACGGCACA GTTAGTGGGGTCTCGCTCCTG Collagen IA 0. 9 97 2. 10 TGACTGGAAGAGCGGAGAGTACT CCTTGATGGCGTCCAGGTT Collagen II 0. 992 2.15 TTCCACTTCAGCTATGGCGA GACGTTAGCGGTGTTGGGAG ... Collagen III 0. 9 97 2 .05 CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0. 992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0. 992 1. 97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA ... were digested with chondroitinase ABC for hours at 37 C Then the sections were treated with 1% H2O2 in methanol for 20 minutes and subsequently washed with 0. 1% Triton X- 100 in PBS for minutes...

Ngày tải lên: 09/08/2014, 10:21

... were lysed with 0. 8ml Tris-HCl 0. 05M pH 7. 5, NaCl 0. 15 M, MgCl2 0. 005 M, Np- 40 0.2% at room temperature for 30 minutes The nuclei and cell debris were removed by centrifugation at 14 ,00 0 rpm minutes ... 9 .00 9 .03 57/ -6 .73 9 were analyzed by gene array (Mergen LTD) The intensity of dots cIAP1 1. 60 67 .03 7/ 35.824 were calculated and standardized by computer The comparison was XIAP -21.9 -5.354 /0. 0414 ... Inhibitor of Apoptosis protein 1, 2, and genes BMC Genomics 200 2, (1): 16 Holcik M The IAP proteins Trends Genet 200 2, 18( 10) : 5 37 17 Huo TI, Wang XW, Forgues M, Wu CG, Spillare EA, Giannini C,...

Ngày tải lên: 02/11/2012, 11:17

... -1.22 0. 87 3.68 ** 0. 68 2. 50 * 1. 90 2.91 * 1.36 BEX1 3.25 5.69 7. 36 ** 3 .08 -0. 17 2.86 4 .72 * 5 .72 CDH1 1.85 3. 70 ** 1. 87 3.85 ** -0. 41 5. 20 0.48 -0. 70 CSTA 2.54 ** 4 .79 ** -1 .06 0. 80 0 .09 -1.93 ... -2. 87 -1.18 S 100 A2 -0. 70 -0. 02 4 .73 ** 0. 08 2.95 ** 1.66 -1 .01 4 .76 ** S 100 P 6.28 ** 8. 57 ** -0. 47 5 .00 6. 80 ** 0. 38 0. 39 0. 13 SLCO4A1 0. 13 2.92 2.81 1.52 4 .74 * 6. 67 ** 2.83 1 .78 STMN1 -1.44 1.41 ... -0. 59 0. 24 2.82 ** 0. 82 1.68 ** 3.24 ** 0. 49 2.81 ** IGSF3 5.61 ** 4.86 -0. 12 6.35 * 0. 19 1.28 4 .71 4.62 INADL 2.44 3. 70 2. 50 7. 65 ** 0. 48 1.48 0. 80 2. 30 ISL1 0. 31 -0. 45 0. 08 2.21 4.61 0. 10 -0. 74 ...

Ngày tải lên: 15/02/2014, 04:20

... Cancer 1 .0 0.8 0. 6 0. 4 1.8 1.6 1.4 1.2 1 .0 0.8 0. 6 0. 4 0. 2 * * pcDNA3 pri-23a miR-23a ASO-NC ASO 0. 2 A B GAPDH pSilencer/ sh-IL6R 1.2 * 0. 40 0.35 0. 30 0.25 0. 20 0.15 0. 10 0 .05 1 .0 0.6 0. 4 0. 2 24 ... 372 6– 373 4 ª 201 0 The Authors Journal compilation ª 201 0 FEBS 372 7 miR-23a promotes gastric cancer growth 0. 6 0. 4 0. 2 1.5 A5 70 B 24 h 1 .0 0.8 90 ASO-NC miR-23a pcDNA3 ASO 48 h * 70 * 1 .0 0.5 ASO-NC ... ASO 72 h A5 70 2 .0 1.5 * * 80 pri-23a Number of colonies A5 70 A 1.2 L.-H Zhu et al * * 60 50 40 30 20 10 1 .0 Fig miR-23a promotes growth activity of MGC 803 cells MGC 803 cells were transfected with...

Ngày tải lên: 18/02/2014, 04:20

... Med 205 , 2 97 318 Furuyama K & Sassa S ( 200 0) Interaction between succinyl CoA synthetase and the heme-biosynthetic enzyme ALAS-E is disrupted in sideroblastic anemia J Clin Invest 105 , 75 7 76 4 ... 63, 1 67 178 23 Ishikawa K, Takeuchi N, Takahashi S, Matera KM, Sato M, Shibahara S, Rousseau DL, Ikeda-Saito M & FEBS Journal 273 ( 200 6) 5333–5346 ª 200 6 The Authors Journal compilation ª 200 6 FEBS ... control) was determined with the Dual-LuciferaseTM Reporter Assay System (Promega, Madison, WI, USA) FEBS Journal 273 ( 200 6) 5333–5346 ª 200 6 The Authors Journal compilation ª 200 6 FEBS 5343 Heme oxygenase-2...

Ngày tải lên: 19/02/2014, 05:20

... in 1 50 lL of 50 mm KPB containing 0. 1% Triton X- 100 Each sample ( 300 lg of protein) was added to the standard reaction mixture of 200 lL, which contained 0. 1 m KPB (pH 7. 4), 15 lm hemin, 100 lgÆmL)1 ... immediately heated for 30 at 100 °C The mixtures without heating were used as a blank for measurement of FEBS Journal 273 ( 200 6) 3136–31 47 ª 200 6 The Authors Journal compilation ª 200 6 FEBS Y Zhang ... Journal 273 ( 200 6) 3136–31 47 ª 200 6 The Authors Journal compilation ª 200 6 FEBS Y Zhang et al Reduced expression of heme oxygenase-2 ( 100 UÆmL)1), and streptomycin sulfate ( 100 lgÆmL)1) For hypoxia...

Ngày tải lên: 19/02/2014, 06:20

... 20 40 60 80 100 102 100 Counts 20 40 60 80 100 101 B 100 104 24% Counts 20 40 60 80 100 100 103 Counts 20 40 60 80 100 102 Counts 20 40 60 80 100 101 gp1 80 Counts 20 40 60 80 100 9% Counts 20 ... 101 102 103 100 101 102 103 Counts 20 40 60 80 100 104 100 101 102 104 CD1d42 100 103 104 100 –Fe 12.2% 101 102 103 104 MHC-II –Fe 101 102 103 104 Counts 20 40 60 80 100 101 ICAM-1 101 102 103 ... 40 60 80 100 100 MHC-I Counts 20 40 60 80 100 A Counts 20 40 60 80 100 CD1d Counts 20 40 60 80 100 Counts 20 40 60 80 100 M Cabrita et al 100 104 100 +Fe 101 102 103 104 +Fe 25.3% 101 102 103 ...

Ngày tải lên: 19/02/2014, 16:20

... the reflectron in the following ratios: 1 .00 0 (precursor ion segment), 0. 9 60, 0. 7 50, 0. 563, 0. 422, 0. 316, 0. 2 37, 0. 178 , 0. 133, 0. 100 , 0. 075 , 0. 056 and 0. 042 (fragment segments) Individual segments ... 10 ng (lane 8), 20 ng (lane 9), 50 ng (lane 10) , 100 ng (lane 11) or 200 ng (lane 12) of nonlabelled GT oligomer The two probes were added to the sample at the same specific activity ( 10 000 ... incubated with ng of [c-32P]-labelled GT probe (GT) in buffer ( 200 mM Tris/HCl, pH 7. 5, containing 7 50 mM KCl, 10 mM dithiothreitol, 50 lgÆmL)1 BSA) in the absence (lane 1) or in the presence of 10 ng...

Ngày tải lên: 21/02/2014, 00:20

... UnC was set at 100 % *P < 0. 05 compared with UnC; **P < 0. 01 compared with UnC; #P < 0. 01 compared with the Ins group, but P > 0. 05 compared with LY-29 400 2.UnC, Ins, LY29 400 2, LY29 400 2 + Ins, as ... H 772 1 cells treated with 15 lM LY29 400 2; LY29 400 2 + Ins, H 772 1 cells treated with both LY29 400 2 and insulin; Mock, H 772 1 cells transfected with pcDNA3 vector; AS-PKB, H 772 1 cells transfected with ... < 0. 01 compared with the UnC group; *P < 0. 05 compared with the UnC or Mock group; #P < 0. 01 compared with the Ins group, but P > 0. 05 compared with the LY29 400 2 group; ##P < 0. 01 compared with...

Ngày tải lên: 21/02/2014, 00:20

... reported by others [22,23] G0-G1: 65 .74 % S-Phase: 26. 27% 20 µM ATP 16 G0-G1: 40. 40% S-Phase: 48.39% 80 100 µM ATP 16 G0-G1: 19.91% S-Phase: 77 . 97% 80 0 20 40 60 80 Fig Effect of ATP and ADP on ... 50 B phospho-p38 37 Cell lysate kD 10 30 60 C [min] ERK 1/2 37 p38 37 Cytosol kD D 10 50 E 75 Nucleus 10 20 30 60 10 20 30 [min] p 105 NF-κB1 p 50 RelA (p65) 50 Fig ATP-mediated activation and nuclear ... treatment with 100 lm ATP for up to 60 (Fig 5C) ATP and ADP inhibit lung cell proliferation Cytosol Nucleus 10 20 30 60 kDa 10 20 30 60 [min] 50 A phospho-ERK 1/2 37 50 B phospho-p38 37 Cell lysate...

Ngày tải lên: 07/03/2014, 12:20

... 105 mL)1) were transferred into fresh culture medium containing 10 lM BrdU for 30 mins before fixing with ice-cold 70 % (v/v) ethanol and permeabilization in M HCl with 0. 5% (v/v) Triton X- 100 ... J.H ( 200 2) Role of p21 in apoptosis and senescence of human colon cancer cells treated with camptothecin J Biol Chem 277 , 171 54– 171 60 28 Sherr, C.J (1993) Mammalian G1 cyclins Cell 73 , 105 9– 106 5 ... phosphothiorated for stability [21,22] They were trioctamers of the CRE consensus site, and their complete sequences were: CDO, 5¢-TGACGTCATGACGTCATGACGTCA-3¢; SO, 5¢-TGT GGTCATGTGGTCATGTGGTCA-3¢ Cells...

Ngày tải lên: 07/03/2014, 15:20

... 500 ; anti(h-geminin) (Santa Cruz), : 500 ; anti-Gem2, : 200 0, anti-hCdc6/18 (Upstate Biotechnology), : 100 0; anti-cyclin A (Upstate Biotechnology), : 200 0, and anti(a-tubulin) (Sigma), : 10 000 ... °C with anti-DIG Ig (1 : 500 0 dilution, Roche) in 0. 1 M Tris/HCl pH 7. 5 /0. 15 M NaCl Slides were rinsed in 0. 1 M Tris/HCl pH 7. 5 /0. 15 M NaCl, equilibrated in 0. 1 M Tris/ HCl pH 9.5 /0. 1 M NaCl/ 50 ... stringency (0. 2· NaCl/Cit at 65 °C) for h and transferred to 0. 2· NaCl/Cit at room temperature for Slides were blocked for h at room temparature, with 10% (v/v) sheep serum in 0. 1 M Tris/HCl pH 7. 5 /0. 15...

Ngày tải lên: 07/03/2014, 16:20

... RPMI 16 40 (Gibco, Cat No 11 877 03 2) supplemented with lM NaH2PO4 for 90 Ó FEBS 200 2 478 2 Y Iida et al (Eur J Biochem 269) Subsequently, cells were fed 0. 4 mCiÆmL)1 [32P]NaH2PO4 for 30 32P-Loading ... CaM kinase II for 30 at 37 °C in the presence of 0. 1 lM calmodulin, in 2 10 lL of 50 mM Tris/HCl ( pH 7. 4) containing 10 lM ATP (2 lCi [c-32P]ATP), mM MgCl2, 1 20 lM CaCl2, and 100 lM EGTA Aliquots ... for 10 at 30 °C, then was terminated by M perchloric acid The 5HTP formed was measured using an HPLC system equipped with a fluorescence monitor (JASCO model, FP9 20) set at 302 nm and 3 50 nm for...

Ngày tải lên: 08/03/2014, 16:20

... 3 70 ± 200 > 10 000 (n ¼ 3) 9 400 ± 4 50 > 10 000 (n ¼ 3) > 10 000 (n ¼ 3) > 10 000 (n ¼ 3) 454 ± 241 (n ¼ 2) 882 ± 286 118 ± 57 – 119 ± 46 93 ± 80 49 ± 23 > 10 000 (n ¼ 3) > 10 000 (n ¼ 3) 4 50 ... over 30 (I), 10 60% over 30 (II), 10 40% over 30 (III) or 20 40% over 30 (IV) Analytical data were as expected [orexin A, 23–33: molecular mass (m), mexpected 103 6 Da; mfound, 103 6.1 ± 0. 5 Da; HPLC ... peptides were dissolved in 20 mM NaCl/Pi at neutral pH containing 0% , 30% , 50% or 70 % trifluoroethanol and in pure trifluoroethanol, in a concentration range of 200 – 300 lM Each measurement was repeated...

Ngày tải lên: 08/03/2014, 22:20

... Journal 275 ( 200 8) 4 571 –4582 ª 200 8 The Authors Journal compilation ª 200 8 FEBS U Ekstrom et al ¨ Internalization of cystatin C Fluorescence (arb units) A 200 0 A 1 500 P < 0. 01 100 0 500 Papain ... A 200 0 A 1 500 P < 0. 01 100 0 500 Papain B Papain + E64 500 Lysate (PBS) Lysate (cys C) P < 0. 01 Fluorescence (arb units) B 400 300 200 100 Cat B Cat B + E64 Lysate (PBS) Lysate (cys C) Fig Papain ... 275 ( 200 8) 4 571 –4582 ª 200 8 The Authors Journal compilation ª 200 8 FEBS 4 579 Internalization of cystatin C U Ekstrom et al ¨ Microscope analyses After incubation with cystatin C, conjugated with...

Ngày tải lên: 16/03/2014, 06:20

... (-mer) 5¢-TGTTTGTTTGTTTGTTTGTTTGTTTGT-3¢ 5¢-TGGTGTGTGTGGGGTGGTTGGTG-3¢ 5¢-TGGGGTGTGTGGGGTGGTTGGTG-3¢ 5¢-TGGGGTGTGTGGGGGGGTTGGTG-3¢ 5¢-TGGTTGGGGTGGGGGGGGGGGTG-3¢ GT GT-G1 GT- G2 GT- G3 GT- G4 27 23 23 ... GT GT-G1 GT- G2 GT- G3 GT- G4 GRO26A GRO29A CD[mdeg] -3 2 20 B 2 40 2 60 2 80 300 Wavelength [nm] 3 20 GRO26A CD[mdeg] -2 2 20 2 40 2 60 2 80 300 Wavelength [nm] 3 20 20 C 37 C 50 C 65ºC 80 C 100 ºC 20 C, H2O ... FEBS Journal 273 ( 200 6) 13 50 1361 ª 200 6 The Authors Journal compilation ª 200 6 FEBS B Scaggiante et al GT oligonucleotides, eEF1A and antiproliferative effect 100 80 60 40 20 TG GT GR O GR 29A...

Ngày tải lên: 16/03/2014, 13:20

... Glc1Man9 113512 11 4 07 0 114418 1 276 50 13 400 0 1343 50 0.88 0. 85 0. 85 145 20 132 50 135 10 7 100 8 206 8214 2 .04 1.61 1.64 of Man8–5GlcNAc1 and Man4GlcNAc1, which are putative degradation signals for glycoproteins ... preincubation times in 0. 175 mM Glc before the 1-h pulse (from 1 20 preincubation for 0% Man5 species to 20 preincubation for 50% Man5 species) OS, Soluble oligomannosides M4, M5, M6, M7, M8, M9 indicate ... in MI8-5 cells MI8-5 cells were preincubated for 20 in the presence of 0. 175 mM Glc and pulse-labeled with [2-3H]Man for h without (A) or with (B) 100 lgÆmL)1 castanospermine After incubation and...

Ngày tải lên: 16/03/2014, 16:20

... 101 102 FL1-H 103 104 101 102 FL1-H 103 104 60 40 Counts 20 80 100 60 40 20 0 100 102 FL1-H 100 Counts 60 40 20 Counts Lung 101 80 100 100 80 100 100 60 80 100 20 0 Counts 102 FL1-H Muscle 101 ... 30 60 90 1 20 1 50 1 80 100 40 Counts 60 20 Bone 40 Counts 80 100 0 FL1-H Blank Standard growth condition Stressed condition 100 Fig DCF oxidation in cells with and without glucose Rho+ and q0 ... Therefore our data could indicate that mtDNA-depleted cells need less Homeostasis of ROS in q0 cells (Eur J Biochem 271 ) 3653 Ó FEBS 200 4 ρ+ 103 104 101 102 FL1-H 103 104 101 102 103 104 103 104 ...

Ngày tải lên: 16/03/2014, 18:20

... This work was supported by Research Grants OTKA T 304 11 (S D.), T34493 (J M.), T0 303 99 (J Sz.), F0 205 90 (L B.), F0252 10, T0 378 31(G V.), F0344 87 (A B.) from the Hungarian Academy of Sciences, by ... 200 2 Compartmentation of IL-2 receptor (Eur J Biochem 269) 1 2 07 Waldmann, T.A ( 200 0) T-cell receptors for cytokines: targets for immunotherapy of leukemia/lymphoma Ann Oncol 11 (Suppl 1), 101 – 106 ... either with Alexa488-conjugated anti-CD48 Ig (MEM 102 ) or with RhRX-conjugated anti-CD25 Ig (Tac) on ice for 40 min, then incubated with anti-IgG (whole chain) RAMIG antibody at 37 °C, for 30 The...

Ngày tải lên: 17/03/2014, 23:20

... China ( 200 7AA02Z165, 200 8DFA 3 07 70 ) , the National Basic Research Program of China ( 200 7CB512 100 ), and the National Foundation of Natural Science (grant 308 71 385) References Bartel DP ( 200 4) MicroRNAs: ... = 0. 001 8 for the comparison between MCF -7 and MDA-MB-231, P = 0. 001 2 for the comparison between T-47D and MDA-MB-231 and P = 0. 001 0 for the comparison between BT- 474 and MDA-MB231, but P = 0. 0399 ... between T-47D and MDA-MB-231; P = 0. 001 0, comparison between BT- 474 and MDA-MB-231; P = 0. 0399, comparison between MCF -7 and SK-BR-3; P = 0. 0123, comparison between T-47D and SK-BR-3; P = 0. 0 07 4, comparison...

Ngày tải lên: 22/03/2014, 21:20