segments distribution of jh gene segments and cdr3 length in patient a

Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc

Ngày tải lên : 09/08/2014, 06:23

... 2 7a in CDR1 (R2 7a) of the B3 λ chain, has arisen by somatic mutation from serine Expression and modification of murine and human anti-DNA antibodies in vitro has shown that removal of arginine ... by adding goat antihuman IgG alkaline phosphatase conjugate and incubating for hour at 37°C Substrate was added and optical density (OD) at 405 nm was read The true OD for each sample was calculated ... Okamura M, Kanayama Y, Amastu K, Negoro N, Kohda S, Takeda T, Inoue T: Significance of enzyme linked immunosorbent assay (ELISA) for antibodies to double stranded and single stranded DNA in patients...

13
472
0

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Ngày tải lên : 07/03/2014, 21:20

... [75Se]Der p and this band could only be detected in the lung Autoradiograms of separated liver and thoracic lymph node proteins revealed a radioactive band of 25 kDa in liver and bands of 30 and ... metabolism of the allergen was altered as a result of the in ammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation In ... the Sel-tag had an intact core sequence and maintained allergen-speciﬁc IgE-binding epitopes and the use of a Sel-tag enabled labelling with the gamma-emitting radionuclide 75Se at a single predeﬁned...

12
518
0

Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc

Ngày tải lên : 17/03/2014, 10:20

... 5¢-GGTGGTA GATGATCGGCAAGGTTTGC-3¢), C130S (forward 5¢CCAATTGGTGTGCTAAAGACTTTG-3¢/reverse 5¢-AA GGATAAATATGTGAGAAGATATTC-3¢), C133 (forward 5¢-CTTTGAAAAATATATCAGAGAAAATG-3¢/ reverse 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), ... 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), C159S (forward 5¢-GCCCACAATAAAGTCAATAAG AAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢), C176S (forward 5¢-CTCCAATTTCTGG GAAAAAAGATGGAAG- 3¢/reverse 5¢-TCAAATTTGG GCTTCCTCAATTTC-3¢) ... ﬁnding was that C133S and C159S always contained a substantially lower amount of protein-bound FAD than all other mutant proteins The FAD content of the mutants C30S and C33S were similar to that...

8
405
0

Báo cáo hóa học: "Multicenter phase II study of matured dendritic cells pulsed with melanoma cell line lysates in patients with advanced melanoma" potx

Ngày tải lên : 18/06/2014, 16:20

... to several prior DC-based approaches Most of the patients had metastatic disease localized in skin and soft tissues, including in- transit lesions Three patients achieved objective and durable tumor ... initiation Patient 095-200 had skin metastasis progressing shortly after receiving adjuvant interferon The patient received a total of vaccinations and achieved a PR (Figure 2d, e), being free of progression ... had Ribas et al Journal of Translational Medicine 2010, 8:89 http://www.translational-medicine.com/content/8/1/89 Page of 11 Table Patient Characteristics Characteristic Table IDD-3 Administration...

11
459
0

Báo cáo hóa học: " Are quantum dots ready for in vivo imaging in human subjects?" docx

Ngày tải lên : 22/06/2014, 18:20

... self-assembly using engineered proteins [51–54] Research has shown that a three-layer method using an antibody against a speciﬁc target, a biotinylated secondary antibody against the primary antibody, ... differ only at a single nucleotide [114, 115] In comparison with planar chips, bead-based multiplexing has many distinct advantages such as greater statistical analysis, faster assay time, and the ... tissues accessible by endoscopy, and intraoperative visualization NIR optical imaging devices for detecting and diagnosing breast cancer have been tested in patients and the initial results are encouraging...

17
377
0

báo cáo khoa học: " Manufacture of IRDye800CW-coupled Fe3O4 nanoparticles and their applications in cell labeling and in vivo imaging" ppt

Ngày tải lên : 11/08/2014, 00:22

... mixture was heated to 320°C at a constant heating rate of 3.3°C/min, in a nitrogen atmosphere, and maintained at that temperature for 30 The resulting solution was cooled and precipitated by an addition ... particular, these biological processes should be investigated in a dynamic and real-time form with living animals In recent years, NIRF labeling has played an increasingly important role in in ... clinical applications of nanoparticles The biodistribution, metabolism, clearance and toxicity of nanoparticles must be examined in animal studies prior to their clinical application Page of 14 In...

14
399
0

báo cáo khoa học: "BRCAA1 monoclonal antibody conjugated fluorescent magnetic nanoparticles for in vivo targeted magnetofluorescent imaging of gastric cancer" ppsx

Ngày tải lên : 11/08/2014, 00:23

... imaging of gastric cancer, and may have great potential in applications such as dual-model imaging and local thermal therapy of early gastric cancer in near future Wang et al Journal of Nanobiotechnology ... biocompatibility and stability [33-38] In this paper, we fully use the advantages of FMNPs and BRCAA1 antigen, prepared monoclonal antibody against BRCAA1 protein, and prepared BRCAA1 monoclonal antibody-conjugated ... imaging and targeting therapy of clinical gastric cancer in near future Materials and methods Preparation of anti-BRCAA1 monoclonal Antibodies Figure MRI image of mice A, FMNPs without coupling...

12
389
0

Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa

Ngày tải lên : 13/08/2014, 09:21

... :5'-CCCTGA CCAAGTATAGCTGTTCAGATCTTTAACTAAATGGTATTC C-3'; for stage 2, downstream mutagenesis, 5'CGCCCTCATATTCTCTGTATAGATCTACCCGCTAGCTTGCATTG-3' and 5'-CAATGCAAGCTAGCGGGTAGATCTATACAGAGAATATGAGGGCG-3' ... region that was to be deleted Mutagenesis was carried out as in two stages using the following primers: stage 1, upstream mutagenesis:- 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' and :5'-CCCTGA ... Gag-Pol was demonstrated by its ability to package both HIV-2 and SIV RNA and effect GFP gene transfer HIV-1 Gag-Pol packaged a greater level of HIV-2 RNA than SIV RNA and a significantly greater...

14
437
0

Báo cáo y học: " A remission spectroscopy system for in vivo monitoring of hemoglobin oxygen saturation in murine hepatic sinusoids, in early systemic inflammation" doc

Ngày tải lên : 13/08/2014, 13:20

... NR participated in design and coordination and OE participated in animal procedures and in drafting the paper All authors approved and read the final manuscript Acknowledgments This work was supported ... depicted in Figure Hepatic tissue injury Serum alanine aminotransferase (ALT) and serum aspartate aminotransferase (AST) levels are summarized in Table When compared with sham animals, mice treated ... each experiment, the white standard of the micro probe was calibrated according to the technical instructions of the manufacturer Measurement of serum alanine aminotransferase (ALT) and aspartate...

8
239
0

Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt

Ngày tải lên : 13/08/2014, 05:20

... to viral replication and viralinduced immortalization in cell culture as well as viral replication kinetics and persistence in inoculated rabbits Our findings indicate that the loss of p28 and ... 729.HTLV-2 Tax-2 -actin 1.7E+0 6.5E+3 2.1E+3 } Copies p28 mRNA Figure permanent of p19 Gag and Expression transfectants Tax protein and p28 mRNA in Expression of p19 Gag and Tax protein and p28 mRNA in ... entail identifying the functional domains of the protein involved in localization, protein interactions, and RNA binding as well as precisely identifying the viral mRNA response element In addition,...

11
277
0

Báo cáo toán học: "Iodine Alters Gene Expression in the MCF7 Breast Cancer Cell Line: Evidence for an Anti-Estrogen Effect of Iodine" doc

Ngày tải lên : 08/08/2014, 17:20

... iodine and iodide in rat thyroid and mammary glands Biol Trace Elem Res 1995, 49:9-19 Funahashi H, Imai T, Tanaka Y, Tobinaga J, Wada M, Morita T, Yamada F, Tsukamura K, Oiwa M, Kikumori T, et al ... CA) and analyzed using flow cytometry (Guava EasyCyte Mini.) RNA isolation Following iodine treatment, total RNA was isolated using RNAeasy mini kits (Qiagen, Valencia, CA) according to the manufacturer ... resulting data was annotated and analyzed using the DAVID Bioinformatics Database Gene Functional Classification Tool (NIAID/NIH) Genes with a greater than fold change in or more arrays were considered...

8
290
0

Báo cáo y học: ""Shock and kill" effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence" doc

Ngày tải lên : 12/08/2014, 23:21

... balance of HAT/HDAC activity towards increased HAT activity and DNA unwinding, thus facilitating the binding of several transcription factors [27] The HIV-1-induced pro-oxidant status is in part ... Structural characteristics of HIV-1 activating HDACIs Structural characteristics of HIV-1 activating HDACIs Panel A: Docking of the HDACI MC2211 at the catalytic cavity of HDAC2, a class I enzyme ... histone acetylation and deacetylation, NF-kappaB and pro-inflammatory gene expression Biochem Pharmacol 2004, 68:1255-1267 Garaci E, Palamara AT, Ciriolo MR, D'Agostini C, Abdel-Latif MS, Aquaro...

10
418
0

INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN

Ngày tải lên : 02/10/2015, 17:15

... chronic pain Amino acids and prostaglandins are two such examples 1.2.1.1 Amino Acids Glutamate is the main excitatory amino acid in the mammalian CNS Its interaction with glutamate receptors mediates ... pain due to osteoarthritis (Sethuraman et al., 2007) Amino acids including aspartate, arginine, asparagine, tyrosine and valine were also demonstrated to be elevated in the CSF of chronic pain ... hand, blocks nociceptin-induced allodynia and hyperalgesia, and also attenuates pain due to prostaglandins In addition, Joseph et al (2007) found increased levels of ppN/OFQ, N/OFQ and NST in...

136
600
0

Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis

Ngày tải lên : 02/11/2012, 11:17

... sequence 3’-GAGGAGACAGTCCTACTGAAA (API1) and 3’-CATAGCATTATCCTTCGGTTC (API2) were used to detect cIAP2 Primers with the sequence 3’-GGGAAGCAGAGATCATTTTGC (API3) and 3’- AACTGAGTATATCCATGTCCC (API4) ... processing of procaspase-3, procaspase-6, and procaspase-7 by binding and blocking the activity of caspase-9 Increasing evidence demonstrated that IAPs are up regulated in many human tumor types and ... caspase-2, caspase-8, caspase-9, and caspase-10, having long NH2-terminal prodomains, which interact with adapter molecules to form a death-inducing signaling complex Downstream caspases such as caspase-3,...

6
514
0

Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

Ngày tải lên : 19/02/2014, 16:20

... media We have also shown that the increase in the prooxidant state caused by iron loading has an impact in protein integrity, as indicated by an increase in protein-bound acrolein adducts at the ... was performed using a Kodak Digital Science DC40 camera and its associated software Band intensities are shown on the right and are expressed as the sum of all pixel intensity values in the band ... of the plasma membrane and that is translocated into the outer face under certain cellular states Double-labeling with Annexin V and CD1d revealed that a large number of HepG2 cells growing in...

14
682
0

$Tài liệu Báo cáo khoa học: Identiﬁcation of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line speciﬁcally binding to aptameric cytotoxic GT oligomers ppt$

Tài liệu Báo cáo khoa học: Identiﬁcation of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line speciﬁcally binding to aptameric cytotoxic GT oligomers ppt

Ngày tải lên : 21/02/2014, 00:20

... Replication protein A is the major single-stranded DNA binding protein detected in mammalian cell extracts by gel retardation assays and UV cross-linking of long and short single-stranded DNA molecules ... performed a comparative bidimensional PAGE analysis of nuclear extracts coupled to Western blotting analysis with an eEF 1A mAb As an internal normalizer of loading amounts and focusing position, ... using the dried droplet technique and a- cyano-4-hydroxycinnamic as matrix, and analysed by using a Voyager-DE PRO mass spectrometer (Applied Biosystems, Framingham, MA, USA) Internal-mass calibration...

12
552
0

Tài liệu Báo cáo khoa học: Insulin/protein kinase B signalling pathway upregulates metastasis-related phenotypes and molecules in H7721 human hepatocarcinoma cell line pptx

Ngày tải lên : 21/02/2014, 00:20

... scanning of the exposed X-ray ﬁlm was used for quantitative measurement of the protein bands The relative expression of PKB was calculated by the intensity ratio of PKB band and b-actin band Assay ... increase rate in SLex was far greater than that of PKB protein and activity in the insulin treated and S-PKB cells, indicating that SLex might be regulated by other insulin-induced factor(s) in addition ... death genes It is reasonable to assume that insulin has an anti-apoptotic effect, since PKB is an important signal transducer of insulin In our laboratory, Wang et al [17] found that in a human...

11
615
0

Báo cáo khoa học: Measuring enzyme activities under standardized in vivo-like conditions for systems biology pdf

Ngày tải lên : 06/03/2014, 09:22

... dedicated assay media We are aware of and ⁄ or involved in such standardization projects for enzyme assays for E coli, lactic acid bacteria and mammalian cells The procedure described in this article ... standards in public databases will be of great help in evaluating the data for use in computer models of metabolic pathways Even more important, however, will be the deﬁnition of standard assay ... understanding of cellular behaviour To achieve this goal, the integration of experimental, computational and theoretical approaches is required [1] For integration into models and exchange of experimental...

12
382
0

Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot

Ngày tải lên : 07/03/2014, 00:20

... function of the Swi1 and Snf5 activator-binding domains The in vivo validation of the Swi1 and Snf5 activator-binding domains is also of interest in relation to the twostep binding mechanism between ... galactose-induced expression of target genes Figure shows that induction of GAL1, GAL10, GAL2 and GAL7 is severely reduced in a strain lacking both the Swi1 and Snf5 activator-binding domains Recruitment ... predominant coactivating role of SWI ⁄ SNF may be at steps downstream of activator binding rather than as a facilitator of activator binding, although these roles are not mutually exclusive, as exempliﬁed...

9
539
0

Báo cáo khoa học: In vivo RNA interference in oyster – vasa silencing inhibits germ cell development pptx

Ngày tải lên : 07/03/2014, 00:20

... gonad (lane 6), and female gonad (lane 7) Twelve micrograms of total protein extract from each tissue was loaded into the gel A single band of about 79 kDa was detected in female and male gonads ... examination, and the rest of the gonad was placed in total RNA and protein extraction solution For dsRNA tracking, 10 oysters were injected with 20 lg of DIG-labelled dsRNA and sampled days after ... UÆlg)1 total RNA; Sigma, Saint-Quentin, France) to prevent DNA contamination RNA concentrations were measured as described above, and RNA quality was checked with a Bioanalyser 2100 (Agilent, Massy,...

8
406
0