secondary digestion of phosphopeptides with endoproteinases asp n and glu c

Management of patients with stroke: Rehabilitation, prevention and management of complications, and discharge planning pot

Management of patients with stroke: Rehabilitation, prevention and management of complications, and discharge planning pot

... incontinence Insufficient evidence ƒƒ interventions for bowel management problems Incontinence of urine and faeces is dramatically increased following stroke The prevalence of urinary incontinence ... as subtle communication deficit, affecting communication interaction, notably non-verbal communication, and communication of nonliteral or inferred information, may also occur following right ... SCREENING Short, standardised cognitive screening measures can be used by a health professional with knowledge and experience of the presentations of cognitive functioning and factors influencing...

Ngày tải lên: 17/03/2014, 15:20

108 683 0
Photocatalytic Degradation of Isoproturon Pesticide      on C, N and S Doped TiO2

Photocatalytic Degradation of Isoproturon Pesticide on C, N and S Doped TiO2

... (b) TCNS15 TCNS10 TCNS5 TCNS3 TCNS1 TCNS0 Absorbance (a.u) Absorbance (a.u) TCNS15 TCNS10 TCNS5 TCNS3 TCNS1 TCNS0 800 Wavelength ( nm ) 1.6 1.8 2.0 2.2 2.4 2.6 2.8 3.0 3.2 3.4 3.6 3.8 4.0 Bandgap ... loading (TCNS5) and further increase results an activity decrease gradually Table BET surface area and particle size of the TCNS catalysts Catalyst TCNS0 TCNS1 TCNS3 TCNS5 TCNS10 TCNS15 Particle ... The band around 1730 cm-1 is attributed to carbonyl group and bands at 1130, 1040 cm-1 are corresponding to nitrite and hyponitrite groups present in TCNS5 and they are absent in TCNS0 which shows...

Ngày tải lên: 26/03/2014, 00:20

10 358 0
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx

Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx

... 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ 5¢-GCACCTCCTGATCTTCCCCCTTCAATCC-3¢ R C- terminal extension TS XL1-blue supercompetent cells (Stratagene) p26 cDNA inserts were recovered ... missing p26 region Mutation Primer sequence N- terminal extension G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ ... sequence 5236 p26 contains two novel N- terminal sequences, one enriched in glycine and the other in arginine Additionally, the C- terminus contains an unusual stretch of residues endowed with...

Ngày tải lên: 30/03/2014, 20:20

14 358 0
Báo cáo hóa học: " Gait characteristics of subjects with chronic fatigue syndrome and controls at self-selected and matched velocities" pdf

Báo cáo hóa học: " Gait characteristics of subjects with chronic fatigue syndrome and controls at self-selected and matched velocities" pdf

... velocity CFS subjects are shown in black and controls in white NS represents non-significant differences and * denotes a significant difference slower velocity, and also to compare the individuals ... contributions 17 LP contributed to the design, data collection, clinical relevance, and analysis of the data presented DR contributed to the design, data collection, technical aspects of the measurements, ... Journal of NeuroEngineering and Rehabilitation 2008, 5:16 T cell activation and irregularities in neuronal and mitochondrial function [2] Although there is no mortality associated with the condition,...

Ngày tải lên: 19/06/2014, 08:20

7 426 0
Creating an Inclusive Environment: A Handbook for the Inclusion of People with Disabilities in National and Community Service Programs ppt

Creating an Inclusive Environment: A Handbook for the Inclusion of People with Disabilities in National and Community Service Programs ppt

... Instance constructor Static constructor Như h c trư c giới thiệu, C c thành ph n class instance static Constructors thành ph n class, Instance constructors Static constructors c kh c nhau? Chúng ta ... ki n th c tảng c a c ng nghệ Net Từ đó, b n tự tin tiếp c n với ki n th c cao c ng nghệ Net Chúng gửi tới b n ki n th c cớ từ quy t c đặt t n, c ch viết c u lệnh, c u tr c lệnh C# đ n ki n th c ... ngữ C# C c b n hình dung c u lệnh lập trình giống với c u v n v nc n tu n theo quy t c định N u ng n ngữ đời sống b n phải di n đạt cho người xung quanh hiểu ng n ngữ lập trình c u lệnh viết...

Ngày tải lên: 28/06/2014, 23:20

103 485 0
Báo cáo toán học: "MacMahon’s theorem for a set of permutations with given descent indices and right-maximal record" ppt

Báo cáo toán học: "MacMahon’s theorem for a set of permutations with given descent indices and right-maximal record" ppt

... xcn yc1 · · · ycn ¯ ¯ c En n 1 n 2 = ··· c1 =0 c2 =0 n 1 = xc1 · · · xcn yc1 · · · ycn ¯ ¯ cn =0 n 2 xc2 yc2 · · · ¯ xc1 yc1 ¯ c1 =0 c2 =0 xcn ycn ¯ cn =0 n 2 = (x1 yn−1 + n 3 xc1 yc1 )(x2 yn−2 ... assistance in making calculations, and to the anonymous referee for essential remarks References [1] A Bj¨rner, M.L Wachs, Permutation Statsitics and Linear extensions of posets, J o Combin Theory, ... permutation σ ∈ Sn is the composition of n whose descents are exactly the set of descent indices of σ, Des(I) = desi(σ) If I = (i1 , , ir ) is a composition of n, then we let D each having descent composition...

Ngày tải lên: 08/08/2014, 12:22

14 415 0
Báo cáo khoa học: "Increasing N and P resorption efficiency and proficiency in northern deciduous hardwoods with decreasing foliar N and P concentrations" doc

Báo cáo khoa học: "Increasing N and P resorption efficiency and proficiency in northern deciduous hardwoods with decreasing foliar N and P concentrations" doc

... range of site conditions, it would appear that both nutrient resorption efficiency and proficiency of hardwoods of eastern Canada increase with a decrease in pre-senescence leaf nutrient concentration ... wide range of pre-senescence leaf N and P concentrations Acknowledgements: Funding was provided by the Natural Sciences Engineering Research Council of Canada REFERENCES [1] Aerts R., Nutrient resorption ... ten for the SBL and the Morgan Arboretum, respectively To assess the effect of pre-senescence leaf N and P concentrations on resorption efficiency and proficiency, mean leaf and litter nutrient...

Ngày tải lên: 08/08/2014, 14:20

7 220 0
báo cáo khoa học:" Quality of life of adolescents with cancer: family risks and resources" pps

báo cáo khoa học:" Quality of life of adolescents with cancer: family risks and resources" pps

... protocol Participant Recruitment Adolescents currently under treatment for cancer and a primary caregiver were recruited from the outpatient clinic and inpatient unit of the cancer center of an ... significantly associated with intensity of treatment and presence of medical complications Speechley and colleagues [3] found that QOL was associated with type of cancer and treatment received Cranial ... predictor in the expected direction of higher family functioning predicting higher psychosocial QOL Discussion Understanding the impact of cancer and treatment on adolescent QOL is of central...

Ngày tải lên: 12/08/2014, 01:21

8 296 0
Báo cáo y học: " Comparison of thromboelastometry with procalcitonin, interleukin 6, and C-reactive protein as diagnostic tests for severe sepsis in critically ill adults" ppsx

Báo cáo y học: " Comparison of thromboelastometry with procalcitonin, interleukin 6, and C-reactive protein as diagnostic tests for severe sepsis in critically ill adults" ppsx

... error of the mean CVVHD, continuous venovenous hemodiafiltration Assays for procalcitonin, interleukin 6, and C- reactive protein concentrations For the determination of procalcitonin concentration, ... and concentrations of procalcitonin, interleukin 6, and C- reactive protein in patients with and without severe sepsis are given as mean and standard error of the mean (SEM), as well as median ... interleukin 6, and C- reactive protein concentrations were tested for differences between patients with and without sepsis Procalcitonin concentration averaged 2.5 ng/ml ± 0.5 in postoperative patients...

Ngày tải lên: 13/08/2014, 21:21

7 449 0
Effect of Surfactant on Degradation of Polycyclic Aromatic Hydrocarbons (pahs) in Thermophilic Anaerobic Co-Digestion of Sludge from Kim-Ngưu River and Organic Waste

Effect of Surfactant on Degradation of Polycyclic Aromatic Hydrocarbons (pahs) in Thermophilic Anaerobic Co-Digestion of Sludge from Kim-Ngưu River and Organic Waste

... Cd Cr Ni Cu Pb Zn PAHs (mg/kg DS) Naphthalene Acenaphthylene Acenaphthene Fluorene Anthracene Fluoranthene Pyrene Benz[b]fluoranthene Benzo[k]fluoranthene Benzo[a]pyrene Indeno[1,2,3-cd]pyrene ... Tween 80) When using nonionic surfactant agent (Tween 80), the degradability of PAHs compounds also increased significantly except rings of PAHs which had not identified in the influent of (SL ... in the case of (SL + OW + Tween 80) made degradability of rings PAHs compounds increase more than rings compounds (fig 4), this phenomenon can be proved that the concentration of rings compounds...

Ngày tải lên: 24/06/2015, 08:16

7 416 1
Chemistry of cyclopentadienylchromium complexes containing c , n  and s  organic ligands

Chemistry of cyclopentadienylchromium complexes containing c , n and s organic ligands

... µ-η1,η1 (N, N’) 51 R R N N M C OC N N OC M CO CO N N Mn Mn CO N N N 10 N N OC C N N N N N C C R R R = CF3 µ-η1,η2 (N, N’ ,N ’) 52 R N C N N N N M C N N N M Y Y N N N N C Chemistry of Cyclopentadienylchromium ... Cr N N S N Cr S Cr N N N N Cr C N N N C S S N N N N S N C N N (5)* (6) N H O BF4 N N (7) Cr C N Cr H O S N Cr C N C S N Cl (12) N N S (9)* Cr Cr Solv Cr N N (8)* Cl N C N N S Cr O N N MeOSO3 Cl ... N N Base C H Fe OC N L CN N N CH3SO3CF3 L C CN N CH3 Fe OC N N N N C CN L = CO, PPh3, P(OMe)3 N Chemistry of Cyclopentadienylchromium Complexes containing C- , N- and S- Organic Ligands 30 Chapter...

Ngày tải lên: 03/10/2015, 20:33

150 357 0
The 11th form non-english majors’ level of satisfaction with their reading comprehension lessons at phan boi chau specialized upper secondary school, nghe an

The 11th form non-english majors’ level of satisfaction with their reading comprehension lessons at phan boi chau specialized upper secondary school, nghe an

... images and sounds Reviewing well Employing action Cognitive strategies Practicing Receiving and sending messages Analyzing and reasoning Compensation strategies Creating structure for input and output ... over and over again • Formally practicing with sounds and writing systems: Students practice sounds (pronunciation, intonation, etc) in a variety of ways but not yet in naturalistic communication ... Beginning Compass Publishing Anderson, J.R (1985) Cognitive Psychology and its Implications San Francisco: Freeman Brown, H.D (2001) Principles of Language Teaching and Learning New York: Addison...

Ngày tải lên: 07/11/2012, 14:54

46 841 3
Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt

Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt

... AcmAreveco CGCGAATTCAGATTATGAAACAATAAG CGCGAATTCTTATGTCAGTACAAGTTTTTG CGCGAATTCCTTATGAAGAAGCTCCGTC CTTCAACAGACAAGTCC AGCAATACTAGTTTTATA CGCGAATTCGCTAGCGTCGCTCAAATTCAAAGTGCG AGGAGATCTGCGACTAACTCATCAGAGG ... GCATGAATTCATCGCGAACTGCTATTGGTTCCAG GGTACTGCCGGGCCTCCTGCGG ACAACTGTTAAGGTTAAATCCGGAGATACCCTTTGGGCG TCAATTCATAAGGTCGTTAAAGGAGATACTCTCTGG AGCGGAATTCAATAATTTATTTTATTCGTAGATACTGACC EcoRI EcoRI EcoRI ... D600 Chain length, halo size surrounding colonies on plates containing M lysodeickticus cells, sedimentation of the cells, AcmA activity in cell extracts and supernatants and cell binding properties...

Ngày tải lên: 19/02/2014, 18:20

15 460 0
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

... undetectable activity on arginine but significant activity on agmatine From the effects of replacement of His120 and His145 with asparagine we conclude that Mn2+A, and not Mn2+B, as occurs in ... corresponding sense mutagenic oligonucleotide primers were 5¢-CTGGGAGGAGA CAACAGCCTGGCAATC-3¢ for His120Asn, 5¢-TGGGTT GATGCCAATGCTGACATCAAC-3¢ for His145Asn and 5¢-TGACATCGACACACCCC-3¢ for Asn14 9Asp Fluorescence ... oligonucleotide primers were: 5¢-gattgccaggctgttgtctcctcccag-3¢, 5¢-GTTGATGTCAGCATTGGCATCAACCCA-3¢ and 5¢-GGGGTGTGTCGATGTCA-3¢ for His120Asn, His145Asn and Asn14 9Asp, respectively The corresponding...

Ngày tải lên: 20/02/2014, 02:21

9 652 0
Báo cáo khoa học: Secondary transporters of the 2HCT family contain two homologous domains with inverted membrane topology and trans re-entrant loops docx

Báo cáo khoa học: Secondary transporters of the 2HCT family contain two homologous domains with inverted membrane topology and trans re-entrant loops docx

... a common evolutionary origin and folding, even though sequence identity between many members cannot be detected anymore Most of the transporters in ST3 transport organic and inorganic anions ... distribution pE(2) ⁄ pE(0) (%) N N C C N N C C N N C C N+ C N C C N N C C N N C C N N +C 0.45 0.51 0.30 0.38 0.45 0.30 0.34 0.32 0.29 0.27 0.61 0.48 0.39 1.0 1.9 0 0 1.4 2.9 1.1 0.9 0.6 0.9 FEBS Journal ... recurring theme in membrane protein structure Aquaporins, ClC chloride channels, the SecY subunit of the protein secretion machinery, the ammonia channel AmtB and the membrane subunit BtuC of the...

Ngày tải lên: 07/03/2014, 17:20

11 367 0
Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot

Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot

... obtained from 2D HSQC, HSQC-TOCSY and HSQC-NOESY at 313 and 323 K (Figs and 4) Clean TOCSY and E-COSY experiments allowed for spin system identification and NOESY cross peaks, connecting HN, Ha and ... length cell The experiments were recorded at 293 K with a nm wavelength increment and accumulation time of s per step Each spectrum was obtained with a protein concentration of mM in presence of ... that these findings could be explained by an interaction between the N- and C- terminal domains in the intact Vpr protein resulting in steric hindrance in the C- terminal recognition motif [8,27]...

Ngày tải lên: 31/03/2014, 23:20

10 476 0
Báo cáo toán học: "Weighted Estimates of Multilinear Singular Integral Operators with Variable Calder´n-Zygmund Kernel for the Extreme Cases" ppt

Báo cáo toán học: "Weighted Estimates of Multilinear Singular Integral Operators with Variable Calder´n-Zygmund Kernel for the Extreme Cases" ppt

... Denote by ˜ χk the characteristic function of Ck and χk the characteristic function of Ck for k ≥ and χ0 the characteristic function of B0 ˜ Definition Let < p < ∞ and w1 , w2 be two non-negative ... singular integral operator, Adv in Math 30 (2001) 63–69 (Chinese) F Chiarenza, M Frasca, and P Longo, Interior W 2,p -estimates for nondivergence elliptic equations with discontinuous coefficients, ... ) and G(f ) is the grand maximal function of f The Herz type Hardy spaces have the atomic decomposition characterization Definition Let < p < ∞ and w1 , w2 ∈ A1 A function a(x) on Rn is called...

Ngày tải lên: 06/08/2014, 05:20

11 230 0
Báo cáo vật lý: "Electrical Conductivity of Chlorophyll with Polythiophene Thin Film on Indium Tin Oxide as P-N Heterojunction Solar Cell" ppsx

Báo cáo vật lý: "Electrical Conductivity of Chlorophyll with Polythiophene Thin Film on Indium Tin Oxide as P-N Heterojunction Solar Cell" ppsx

... Electrical Conductivity Measurement of Thin Film Electrical conductivity is the capacity of any object or substance to conduct an electric current When an electrical potential difference is placed ... spin coating technique The electrical conductivity in dark condition was increased with the increasing of PT thin film thickness While, with the increasing of CHLO thin film thickness, electrical ... efficiencies can be achieved in composite systems including both electron donating and accepting components Efficiencies of over 2% have now been reported in four different types of organic solar cells...

Ngày tải lên: 07/08/2014, 14:20

16 381 0
Báo cáo toán học: " The Number of [Old-Time] Basketball Games with Final Score n:n where the Home Team was never losing but also never ahead by more than w Point" pot

Báo cáo toán học: " The Number of [Old-Time] Basketball Games with Final Score n:n where the Home Team was never losing but also never ahead by more than w Point" pot

... suitable initial conditions gives rise to Cw Notice that these are recurrences with constant coefficients in w but, of course, not in z This explains the relationship of the denominators with Tchebyshev ... C1 = 1/(1 − z) Then Cw = w−2 terms (3) is a patently nonlinear recurrence for the generating function But it does lead to a linear recurrence for the numerator and denominator of Cw This can ... of generating functions in the proof Let fw (z) denote the [ij] generating function of the [ij] walk with width w And let gw (z) denote the generating function for the corresponding irreducible...

Ngày tải lên: 07/08/2014, 15:22

8 299 0
w