scripts bullets and the one two punch a peek into the stockbrokers bag of tricks
Báo cáo y học: " A two-year survey of the oseltamivir-resistant influenza A(H1N1) virus in Yamagata, Japan and the clinical effectiveness of oseltamivir and zanamivir" potx
Ngày tải lên :
12/08/2014, 04:20
... Page of A/ Yamagata/55/2009 A/ Yamagata/57/2009 A/ Yamagata/76/2009 A/ Yamagata/120/2008 A/ Yamagata/133/2008 A/ Yamagata/26/2009 A/ Yamagata/126/2008 A/ Yamagata/77/2009 A/ Yamagata/20/2009 A/ Yamagata/10/2009 ... A/ Yamagata/77/2009 A/ Yamagata/36/2009 A/ Yamagata/29/2009 A/ Yamagata/51/2009 A/ Yamagata/20/2009 A/ Yamagata/133/2008 97 A/ Yamagata/125/2008 A/ Yamagata/126/2008 A/ Yamagata/53/2009 A/ Yamagata/26/2009 A/ Yamagata/16/2009 ... A/ Yamagata/10/2009 A/ Yamagata/51/2009 95 A/ Yamagata/53/2009 G18 5A A/Yamagata/128/2008 A/ Yamagata/16/2009 A/ Yamagata/29/2009 A/ Yamagata/61/2009 A/ Yamagata/125/2008 A/ Yamagata/36/2009 G185V A/ Yamagata/48/2009 A1 89T...
- 8
- 382
- 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx
Ngày tải lên :
14/02/2014, 21:20
... physicians and other healthcare professionals who treat pain from cancer at any stage of the disease with the hope of raising awareness of the types of therapies that may be appropriate and increasing ... working and the education of all healthcare professionals involved in the treatment of cancer pain • The principles of pain management and palliative care for adult practice are relevant to paediatrics, ... glutamate, and to the initiation and maintenance of neuronal activation 18 2.2.3 Central (ascending) (Figure 3) Figure • The ascending pathways are the spinothalamic and parabrachial neurones • The...
- 116
- 548
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Ngày tải lên :
16/03/2014, 13:20
... 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ Preparation of Ec DosH The (His)6-tagged Ec DosH proteins (wild-type and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...
- 14
- 390
- 0
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
Ngày tải lên :
23/03/2014, 04:20
... States, the internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing ... CAE of a global defense and aerospace company that buys parts from around the world said that vendor quality and standards are of primary concern to all global companies She said that when she assesses ... impacting internal audit today and in the future As organizations expand to take advantage of global markets and supply chains, internal audit faces a burgeoning need for its services A majority...
- 68
- 456
- 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
Ngày tải lên :
31/03/2014, 07:20
... DNAs as templates and the synthetic primers legF1 (5¢-AGC AGCAGATTGTAATGGTG-3¢) and legR1 (5¢-CAGC ACTTCAGAATCAGAGTC-3¢) PCR products were cloned on pT7Blue T-vector (Novagen, Darmstadt) and their ... TGCATGT-3¢; the 4-kDa peptide C-terminal primer: 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned into the plasmid pKF18 via the EcoRI and SalI restriction sites in the ... TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements both in the locked, inactive state and in the unlocked state...
- 8
- 386
- 0
báo cáo hóa học: "Evaluation of the impact of fibromyalgia on patients'''' sleep and the content validity of two sleep scales" pptx
Ngày tải lên :
18/06/2014, 18:20
... a week Additionally, each of the participants reported pain in all four quadrants of their body, and their average typical pain level was 6.0 on a 0- to 10-point scale (0 indicating no pain and ... provided a broad range of areas on which FM had a significant and negative impact, including their mood, family and social relationships, and work productivity One participant stated that "it affects ... (65%) and female (80%) Participants reported having a diagnosis of FM for 8.9 years on average, and most of the participants reported that a rheumatologist (40%) or a primary care practitioner...
- 7
- 526
- 1
báo cáo hóa học:" Evaluation of the impact of fibromyalgia on patients'''' sleep and the content validity of two sleep scales" ppt
Ngày tải lên :
20/06/2014, 16:20
... a week Additionally, each of the participants reported pain in all four quadrants of their body, and their average typical pain level was 6.0 on a 0- to 10-point scale (0 indicating no pain and ... provided a broad range of areas on which FM had a significant and negative impact, including their mood, family and social relationships, and work productivity One participant stated that "it affects ... (65%) and female (80%) Participants reported having a diagnosis of FM for 8.9 years on average, and most of the participants reported that a rheumatologist (40%) or a primary care practitioner...
- 7
- 417
- 0
Social media and the 7 steps of Buiding a new media strategy
Ngày tải lên :
03/07/2014, 09:44
... SERVICE DIGITAL AND TRADITIONAL DESIGN & DEVELOPMENT Website design and development Web application and data gathering backend design, development and management Print collateral design and development ... value in the message itself MEDIA-ENABLED SOCIALIZATION AKA SOCIAL MEDIA The term ‘Social Media’ is backward ‘Social’ should not describe ‘media’, ‘media’ describes the means of socialization Focus ... products and services to grow brands & sales CAPABILITIES: CONTENT MARKETING Blogs Video assets iPhone and Facebook apps Podcasts eBooks (developed on the iPad and NOOK friendly ePub standard) Email...
- 39
- 231
- 0
Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc
Ngày tải lên :
12/08/2014, 15:20
... the aim of validating the questionnaire (Lendal et al 1998) Data analysis Initially bivariate analyses were performed, and variables having p-values below 0.15 were included in the multivariate ... between the logarithm of EPG pretreatment and EPG post-treatment) with standard errors (SE) and P-values from bivariate and multivariate analysis are listed Risk factors (levels) N Bivariate analysis ... factors associated with high endoparasite burden and 2) to evaluate the efficiency of a single anthelmintic treatment of Danish horses Materials and methods In 1994 veterinarians from "The Danish...
- 8
- 294
- 0
Báo cáo y học: "Associations between the HLA-A polymorphism and the clinical manifestations of Behcet’s disease" pps
Ngày tải lên :
12/08/2014, 15:22
... effect of HLA -A* 02:07 and A* 26:01 and their genetic interaction with HLA-B*51 on these clinical manifestations (Table 5) There was a trend that HLA-B*51 and HLA -A* 02:07 are additive to All subjects ... was not escalated with the combination of HLAB*51 and HLA -A* 26:01 than with either one of the two alleles Discussion The present study shows that three HLA -A alleles, A* 02:07, A* 26:01, and A* 30:04 ... genotyped the HLA -A gene in Korean BD patients and investigated the associations between its alleles and BD and the clinical features of BD Page of phycoerythrin-conjugated streptavidin and immediately...
- 9
- 325
- 0
Báo cáo khoa học: " Ruminal acidosis and the rapid onset of ruminal parakeratosis in a mature dairy cow: a case report" doc
Ngày tải lên :
12/08/2014, 18:22
... Acta Veterinaria Scandinavica 2009, 51:39 condition of ruminal parakeratosis The characteristics of ruminal parakeratosis include accumulated layers of keratinized, nucleated squamous epithelial ... not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:39 ventral sac of the rumen via the cannula immediately after the final day of the HF and HG treatments Rumen papillae biopsies ... clearly detected The two levels of strata adjacent to the basal lamina are the stratum basale and stratum spinosum which have functional mitochondria contributing to the metabolic properties of...
- 6
- 333
- 0
Báo cáo y học: "HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form" pdf
Ngày tải lên :
13/08/2014, 01:20
... MO042 gag p24 OF- 1 890-909 TAGTATGGGCAAGCAGGGAG MO024 gag p24 OF- 2 508 - 527 AACCCACTGCTTAAGCCTCA MO044 gag p24 OR 2272-2252 TGCCAAAGAGTGATTTGAGGG MO043 gag p24 IF 1048-1067 TGYGTRCATCAAARGATAGA MO045 ... CAAGCATGKGTAGCCCAGAYATTATG MO188 p24 to env IF 2034 - 2060 ATGTGGGAARGARGGACACCAAATGAA MO189 p24 to env IR 6335 - 6360 TCCACACAGGTACCCCATAATAGACT MO191 5’ LTR to gag p24 OR 832 - 859 AATGCTGWRAACATGGGTATTACTTCTG ... Fajara, the Gambia, who had archived plasma samples available Patient selection was based on two criteria (see below) and PCR was attempted on a total of 53 patient samples: the first group of...
- 14
- 334
- 0
Báo cáo y học: "Assessing the psychometric properties and the perceived usefulness of the BasisRaadsOnderzoek (BARO) as a first-line screening instrument for juvenile offenders" ppt
Ngày tải lên :
13/08/2014, 18:22
... finally, the CPB workers evaluated the BARO as a useful and practicable instrument The BARO allows the formulation of well-founded advice Internal consistency analysis has shown that the Yindex and the ... classified [2] Finally, in collaboration with the CPB, a standard instrument layout was worked out: the front page for all relevant personal and (historical) offense related information (standardized ... guide was added [2] The secondary analysis led to the Dutch version The instrument was also translated into English, German, Russian and Finnish It is being used in Switzerland, Austria and Finland...
- 7
- 382
- 0
maxwell - the price is wrong; understanding what makes a price seem fair and the true cost of unfair pricing (2008)
Ngày tải lên :
01/11/2014, 17:44
... to the legal scholars of the period (the Canonists and the Romanists), whatever two people agreed upon.14 A fair settlement was based on the Aristotelian idea of the mean: halfway between the two ... commands more money than a mouse The difference is between “natural value” and “economic value.” Economic value, Aquinas held, was based on demand Demand, as cited by both Albert and Aquinas, appears ... that all sources of data are valuable—anything that can help us understand the slippery idea of price fairness The organization of the book is in three parts: background, model, and applications...
- 259
- 672
- 0
Biological properties and the nutrition value of an Isochrysis strain as a live food for geo-duck larvae
Ngày tải lên :
13/08/2015, 00:34
... for strain was f/2 The Isochrysis galbana strain showed a huge range of fatty acids among, contained remarkable amount of PUFA and considerate level of EPA and DHA which play an essential role ... shirai, Katsumi Matumaru, Akio Ohotake, Yoshichika Takamura, Tokujiro Adia and Masayasu Nakano (1989), “Development of a Solid medium for Growth and Isolation of Axenic Microcystis Strains (Cyanobacteria) ... Myristic acid Palmitic Acid Palmitoleic Acid Stearic Acid Oleic Acid Linoleic Acid Anpha-Linoleic Acid Octadecatetraenoic Eicosapentaenoic Acid (EPA) Benhenic acid Docosahexaenoic Acid (DHA) 4.16...
- 5
- 404
- 0
Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná
Ngày tải lên :
09/09/2015, 10:32
... [17] has found a difference of 5,5% between annual average daily irradiation obtained at the weather station INMET and database SWERA To conclude, this paper considered 5,5% of the annual average ... period of photovoltaic generation (R$/kWh) The equations 6, and show the calculation of the monthly financial return, while the Equations 9, 10 and 11 shows the calculation of the annual financial ... until the result was the amount of capital invested in the project n ∑ RFATi (2) i where i is the year; RFAT the annual financial return of the year i Logically, the weekly financial return was calculated,...
- 12
- 431
- 0
The religious and the scientific thought of zhu xi how the two are related
Ngày tải lên :
14/09/2015, 08:25
... understanding of ri as butsuri The pursuit of each of these two can and should entail the pursuit of the other But to return to Sakuma, his understanding of ri was contrasted with that of another ... soon lost the qualities of personality and creativity The development of the concept of precisely formulated abstract laws capable, because of the rationality of an Author of Nature, of being ... that Zhu assigned at least two meanings to the term xin (heart or mind), one of them as simply the bare faculty of cognition and the other as a manifestation of the li which we are familiar with.33...
- 247
- 811
- 0
A plague o both your houses medicine, power and the great flu of 1918 1919 in britain and singapore
Ngày tải lên :
13/10/2015, 15:54
... Overshadowed by World War One and possessing little of the horrors and stigma of cholera and bubonic plague, the Great Flu provoked a re-examination and refinement of the status quo rather than a ... the same time and place; Italians called these outbreaks influenza di catarro or influenza di febbre scarlattina.16 The English and Americans assigned the names the gentle correction’ and the ... Germans and the Dutch had their fair share of finger-pointing at each other; and the pandemic of 1889-1890 was known to Germans, Italians, French, and English (and is still known to us today) as...
- 107
- 569
- 0
RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE
Ngày tải lên :
14/10/2015, 07:57
... Jin and M Ru,Algebraic curves and the Gauss map of algebraic minimal surfaces, Differential Geom Appl., 25 (2007), 701-712 [12] Y Kawakami, R Kobayashi, and R Miyaoka, The Gauss map of pseudoalgebraic ... Dethloff and P H Ha, Ramification of the Gauss map of complete minimal surfaces in R3 and R4 on annular ends, Ann Fac Sci Toulouse Math., 23 (2014), 829-846 RAMIFICATION OF THE GAUSS MAP AND THE ... whether we may show a relation between of the ramification of the Gauss map and the total curvature of a complete minimal surface The main purpose of this article is to give an affirmative answer...
- 24
- 372
- 0