scoring and initial validation of pact q original structure
báo cáo hóa học: " Measuring the ICF components of impairment, activity limitation and participation restriction: an item analysis using classical test theory and item response theory" potx
... conception and design of the study, the analysis and the drafting and revision of the manuscript MJ participated in the conception and design of the study and the drafting and revision of the manuscript ... for quality of life questionnaire reduction Health and Quality of Life Outcomes 2003, 1:27 Fayers PM, Machin D: Factor analysis In Quality of life Assessment in Clinical Trials: Methods and Practice ... has been the standard method of item analysis and has been a valuable tool over many years [20] However, CTT depends on the nature and size of the sample and the nature and number of items as well...
- 20
- 557
- 0
Đề tài " Higher composition laws I: A new view on Gauss composition, and quadratic generalizations " docx
... the three quadratic forms Q1 , Q2 , Q3 , where Q1 = γ1 Q1 Now the Cube Law implies that the sum of Q1 , Q2 , Q3 is zero, and also that the sum of Q1 , Q2 , Q3 is zero Therefore Q1 and Q1 become ... A of discriminant D such that QA , QA , QA are primitive, we have [QA ] + [QA ] + [QA ] = [Qid,D ] Conversely, given Q1 , Q2 , Q3 with [Q1 ] + [Q2 ] + [Q3 ] = [Qid,D ], there exists a cube A of ... of discriminant D, unique up to Γ-equivalence, such that QA = Q1 , QA = Q2 , and QA = Q3 The most natural choice of identity element in Theorem is D 1−D Qid,D = x2 − y or Qid,D = x2 − xy + (2)...
- 35
- 430
- 0
A Boy I Knew and Four Dogs ppt
... sneak; and a snip; and a snide; and a snob; and a snoozer; and a snarler; and a snapper; and a skunk And I hate you; and I loathe you; and I despise you; and I abominate you; and I scorn you; and ... Hook one summer, and they used it for the transportation of their chestnuts and their currants and their apples, green and ripe, and the mail, and most of the dust of the road; and Bob thinks, ... scholar, and a ripe and good one Self-made and self-taught, he began the serious struggle of life when he was merely a boy himself; and reading, and writing, and spelling, and languages, and A Boy...
- 35
- 378
- 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT PrimEx Figure of canis familiaris sequence and sequences of the MDCK EcoRI-BamHI fragment in pK9Pol I EB Alignment Alignment of canis familiaris sequence and sequences of the MDCK EcoRI-BamHI ... pAD4000 Size of MDCK sequences upstream of transcription initiation site (bp) Figure moter activity Evaluation of MDCK sequences required for RNA pol I proEvaluation of MDCK sequences required for ... features of the RNA pol I promoters and rRNA genes from other mammalian species In the genomes of human, mouse and rat, the distance from the beginning of the 18S rRNA sequences to Page of 12 (page...
- 12
- 567
- 0
Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part I: A unified approach for representing action, quantitative evaluation, and interactive feedback" ppt
... precise definition of how velocity profile is being assessed A simple, quantified representation of action can facilitate online and offline assessment of the movement by the clinician and form the ... introducing new types of feedback that relate to both KR and KP Furthermore, differences arise among definitions of KR and KP in terms of both type of information conveyed and time of delivery with ... The appropriate timing and execution of forearm rotation in the context of a reach and grasp action can pose challenge for stroke survivors [31] and may require monitoring and feedback for assistance...
- 15
- 608
- 0
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf
... GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT PrimEx Figure of canis familiaris sequence and sequences of the MDCK EcoRI-BamHI fragment in pK9Pol I EB Alignment Alignment of canis familiaris sequence and sequences of the MDCK EcoRI-BamHI ... pAD4000 Size of MDCK sequences upstream of transcription initiation site (bp) Figure moter activity Evaluation of MDCK sequences required for RNA pol I proEvaluation of MDCK sequences required for ... features of the RNA pol I promoters and rRNA genes from other mammalian species In the genomes of human, mouse and rat, the distance from the beginning of the 18S rRNA sequences to Page of 12 (page...
- 12
- 627
- 0
Báo cáo lâm nghiệp: "Evapotranspiration of a declining Quercus robur (L.) stand from 1999 to 2001. I. Trees and forest floor daily transpiration" ppsx
... flux density of tree i (l h–1 dm–2) and pi is the proportion of trees with sapwood area SAi in the stand (Tab III) Oak and maple SFD are considered as representative of the ring-porous (Quercus rubra, ... representative of that plot herbaceous species composition and cover At the beginning of a measurement, the chamber is set down on the location and kinetics of 2–3 min, with records of each instrument ... control plot and 0.8 mm d–1 in the thinned one, between DOY 138 and 146 Right after, SFD decreased, probably as the result of caterpillars attacks, low PET and of the beginning of soil water...
- 10
- 365
- 0
Báo cáo khoa học: "Robot-assisted complete excision of choledochal cyst type I, hepaticojejunostomy and extracorporeal Roux-en-y anastomosis: a case report and review literature" ppsx
... Division of General Surgery, Department of Surgery, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand 2Division of Pediatric Surgery, Department of Surgery, Faculty of Medicine ... application of minimally invasive techniques to increasingly complex procedures However, standard laparoscopic approach of hepatobiliary surgery is still limited due to the technical complexities of these ... rigid nature of the instruments with limited degrees of freedom, coupled with the fulcrum effect of laparoscopy and 2-dimensional imaging, certainly contributes to the limitations of the laparoscopic...
- 4
- 264
- 0
Báo cáo y học: " Improvement of pain and regional osteoporotic changes in the foot and ankle by low-dose bisphosphonate therapy for complex regional pain syndrome type I: a case series" pptx
... bone turnover and foot pain (VAS score of 83 out of 100) One month after the start of alendronate treatment, bone pain had fallen from a VAS score of 83 out of 100 to 30 out of 100 and was further ... observed improvement of pain and osteoporotic changes was a consequence of spontaneous amelioration of the disease However, in regard to the immediate improvement of pain and regional osteoporosis ... after the start of risedronate treatment, bone pain had fallen from a VAS score of 59 out of 100 to 18 out of 100, and we temporarily discontinued treatment at five months because of successful...
- 6
- 371
- 0
Báo cáo y học: "Rare association between cystic fibrosis, Chiari I malformation, and hydrocephalus in a baby: a case report and review of the literature" potx
... http://www.jmedicalcasereports.com/content/5/1/366 Page of Table Previous reports of cystic fibrosis (CF) and Chiari malformation Reference Age Sex Presenting signs and symptoms Radiologic findings (extent of Chiari, ± aqueductal stenosis, ... production of this manuscript Authors’ contributions AJP and VHR were major contributors in the writing and editing of the manuscript AJ was a major contributor in the interpretation and analysis of ... malformation, and hydrocephalus in a baby: a case report and review of the literature Journal of Medical Case Reports 2011 5:366 Submit your next manuscript to BioMed Central and take full advantage of: ...
- 4
- 438
- 0
Báo cáo y học: "Dentin dysplasia type I: a case report and review of the literature" ppsx
... usually have early exfoliation of the teeth and, consequently, maxillomandibular bony atrophy, treatment with a combination of onlay bone grafting and a sinus lift technique to accomplish implant ... were impacted and located horizontally in panoramic view (Figure 4) On the basis of the clinical and radiographic appearance, a diagnosis of DD type I, subtype 1a, was suspected Clinical and radiographical ... in most of the teeth The maxillary and mandibular central and lateral incisors were mobile, and there was a painful expansion on the buccal region of the mandibular left first molar Information...
- 6
- 484
- 0
Báo cáo y học: "Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - nonscleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining" potx
... III after the initial visit and increasing total skin score and onset of renal crisis over time [15] Another study reported an association of anti-RNAP III levels and skin score and a negative ... African Americans, and of mixed ethnic background Sixteen of 21 cases had a diagnosis of SSc at the initial visit while did not (Table 1) In the Caucasian patients, 14 out of 18 were diagnosed ... immunoprecipitated RNAP I and III (Figure 1A) The intensity of RNAP I and III were similar in two patients who developed SSc later (cases 1and 2, lanes and in Figure 1A) and a patient with SSc who...
- 7
- 319
- 0
Báo cáo y học: " Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes" ppsx
... between activation of caspase-3 and the increase of nuclear ΔNH2p65, densitometric analysis of gel bands showed that there was no linear correlation between nuclear increase of ΔNH2p65 and nuclear translocation ... after quantification of HIV-1 p24-gag antigen in the culture supernatant Efficient expression of proteins p65wt-tag and ΔNH2p65-tag was determined by immunoprecipitation of 200 μg of cytosolic and ... DNA-binding and transcriptional activity of ΔNH2p65 Analysis of Analysis of DNA-binding and transcriptional activity of ΔNH2p65 (a) Proteins p65wt-tag, p65 D94E;D97E-tag, ΔNH2p65-tag and NF-κB1/p50...
- 20
- 314
- 0
Báo cáo y học: "Mortality associated with HIV-1, HIV-2, and HTLV-I single and dual infections in a middle-aged and older population in Guinea-Bissau" potx
... median follow-up time of 3.8 years (range 0.0–12.4) and 3.0 years (0.0–10.5) respectively Median age of participants were 53.2 (interquartile range (IQR) = 45.9–61.0), and 49.4 (IQR = 39.2–58.2), ... during Table 5: Mortality rates and mortality rate ratios for HIV, irrespective of HTLV-I status MRs and MRRs below and above 45 years of age are compared HIV-1 and HIV-1 + HIV-2 dually infected* ... dually infected* Age group MEN = 45 Test of homogeneity of effect modification of age WOMEN = 45 Test of homogeneity of effect modification of age HIV-2 single infected† Mortality rate/1000...
- 9
- 336
- 0
Báo cáo y học: " Involvement of HTLV-I Tax and CREB in aneuploidy: a bioinformatics approach" pot
... Tax on Sgt1 and p97 protein levels Effect of5 Effect of Tax on Sgt1 and p97 protein levels A) One hundred microgram of total cell extracts from human (CEM and C81) and mouse (CTLL/WT and CTLL/703) ... Recruitment of CREB and basal transcription machinery at the Sgt1 and p97/Vcp promoters Recruitment of CREB and basal transcription machinery at the Sgt1 and p97/Vcp promoters A) Presence of Pol II ... and4 p97 ChIP results Sgt1 and p97 ChIP results A) and B) are the graphical representations of the Sgt1 and p97 ChIP results obtained from CTLL/WT and CTLL/703 cells shown in Figure (Average of...
- 21
- 531
- 0
Báo cáo sinh học: "Mapping quantitative trait loci (QTL) in sheep. I. A new male framework linkage map and QTL for growth rate and body weight" potx
... of regression parameters; = sire family allelic QTL effect (Q relative to q) ; qi = unobserved QTL allele of animal i, = if Q, if q; and i = random error, assumed N(0,2) Note the Merino dam ... Summary of results using QTL-MLE and QTL Express Values in table are estimated QTL positions (cM) This table shows the average QTL positions of all QTL presented here using both programs QTL-MLE and ... with the development of components of the QTL-MLE R coding, and Sally Isberg for conducting testing of the QTL-MLE program and the initial QTL analyses Animals were housed and maintained in accordance...
- 17
- 338
- 0
600 sentences of certificate A and B
... make a lot of money and give jobs to a great deal of people a rubber b make c a lot of d a great deal of > d 76 Around the age of sixteen you must make one of the biggest decision of your life ... d went off > c 239 I've been trying to him all day a fall in love with b take track of c take advantage of d get in touch with > d 240 An ever-growing proportion of this consists of unburned ... electricity a used b being c But now d are > b 33 This house is often broken off and a lot of things are taken away a is b broken c off d away > c 34 My father has a mechanic to repair his motorbike...
- 280
- 884
- 3
Giải chi tiết đề ĐH khối A
... → 2M2On (1) M2On + 2nHCl → 2MCln + nH2O (2) a a/2 a/2 a.n (mol) Page of Phan Khánh Phong THPT Sơn Dương – Sơn Dương – Tuyên Quang m M = a.M = 2,13g Ma = 2,13 (g) => Theo ta có: a m ... CHO nhường e cho N+5 HNO3 nên ta có C+1 – 2e → C+3 N+5 + 1e → N+4 Page of Phan Khánh Phong THPT Sơn Dương – Sơn Dương – Tuyên Quang 0,05 ¬ 0,1 0,1 Bảo toàn e : nanđehit = 0,05 mol => MRCHO = 2,24 ... định luật bảo toàn e ta có : 3x = 2y + 0,18 (**) x 3x x y 2y Page of (mol) Phan Khánh Phong THPT Sơn Dương – Sơn Dương – Tuyên Quang 56 x + 16y = 11,36 x = 0,16 => => m Fe(NO ) = 0,16.242...
- 7
- 359
- 0
Test yourself A and Test 1(Kiều Tính)
... made illegal such as gambling and drug use Research has shown that recreation contributes to life satisfaction, quality of life, health and wellness, and that the use of recreation as a diversion ... the Indians and the Chinese when choosing a wife or a husband A of B on C in D with He left the gas on, ? A didn’t he B had he C was he D wasn’t he Michael took a photograph of Sandra while ... Reading: (2,0 pts) Read the following passage and answer the questions below: Recreation is the use of time in a manner designed for refreshment of one's body or mind In our modern time, people...
- 5
- 719
- 1
- xác nhận giá trị sử dụng của các quá trình sản xuất và cung cấp dịch vụ validation of processes for production and service provision
- initial recognition of an asset or liability in a transaction that is not a business combination and affected neither accounting profit nor taxable income
- adjustments to the initial value of the identifiable assets and the liabilities assumed shall be considered to have been carried out at the acquisition date
- the value of goodwill or negative goodwill shall be corrected with effect from the acquisition date by an amount equal to the adjustment to the initial value of the identifiable assets and the liabilities assumed or to the cost of the combination
- equations boundary and initial conditions structure of s and qc
- intensive initial training of therapists and a local supervisor
- experimental investigation and computational validation of thermal stratification in piping syst
- validation of blood particles microbe contamination and residue of chemicals used
- installing and configuring initial instances of ssrs
- postmortem dna qc considerations for sequence and dosage analysis of genes implicated in long q
- presentation investigations and initial management of acute non odontogenic oro facial pain
- initial validation of the original structure and scoring
- stability dynamic and aeroelastic optimization of functionally graded composite structures
- sites initial methionines utrs and other aspects of protein coding gene structure
- jones g harding p berry i wiklund w h chen and n kline leidy development and first validation of the copd assessment test test eur respir j 34 3 648 54
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008