sclerosants in microfoam a new approach in angiology

... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical significance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcinoma J Gastroenterol ... intracellular localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki ... 24 Zhang T, Maekawa Y, Hanba J, Dainichi T, Nashed BF, Hisaeda H, Sakai T, Asao T, Himeno K, Good RA & Katunuma N (2000) Lysosomal cathepsin B plays an important role in antigen processing, while...

Ngày tải lên: 07/03/2014, 09:20

... elektrostaattisen attraktion vaikutusta Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion kasvuun kitosaanin läsnä ollessa, ... are thanked for the kind, helpful, and inspiring working environment Aila Rahkola, Marja Kärkkäinen, and Ritva Kivelä are thanked for their invaluable help in the laboratory work Librarian Kati ... paper are of prime importance in regard to paper manufacturing and the end-uses of paper products as well as in paper recycling Almost as long as man has made paper, first by hand and then industrially,...

Ngày tải lên: 18/03/2014, 02:20

... an active complex that mediates an intracellular event (for example, activation of adenylate cyclase) The Gα subunit is activated and starts a cAMP signalling cascade, as shown in Figure The international ... the data All the authors have been involved in drafting and revising the manuscript and have read and approved the final manuscript Author Details 1DIMORFIPA, University of Bologna, Italy, 2Faculty ... subjects in the two intermediate areas (yellow and orange) have been interpreted as having a misleading diagnosis of major depression, as described in the literature [14] (b) SOM areas Green = normal,...

Ngày tải lên: 08/08/2014, 23:21

... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...

Ngày tải lên: 13/11/2014, 10:46

... of inflammation) increased in wounded skin, and PAG administration significantly reduced MPO activity in wounded skin compared to non-treated animals Histological analysis also revealed that aggregated ... area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area for each group of rats The data of 6th day suggests the largest ... regulates many essential functions such as maintaining background vasodilatation in small arteries and arterioles, regulation of microvascular and epithelial permeability NO’s role as a neurotransmitter...

Ngày tải lên: 26/09/2015, 09:39

... a biological model with time delay, Proc Amer Math Sot 96, 75-78, (1986) 15 S Jianhua and W Zhicheng, Global attractivity in a nonautonomous delay-logistic equation, Tamkang Jownal of Mathematics ... GyGri, Interaction between oscillation and global asymptotic stability in delay differential equations, Differential and Integral Equations 3, 181-200, (1990) I Gyiiri, Global attractivity in nonoscillating ... delays play role in our conditions but only trough the time dependent global attractor Section contains an entirely new approach of the global asymptotic stability analysis of nonautonomous delay...

Ngày tải lên: 29/10/2015, 14:19

... III Least Action in Quantum Mechanics 24 The Lagrangian in Quantum Mechanics 26 The Calculation of Matrix Elements in the Language of a Lagrangian 32 The Equations of Motion in Lagrangian Form ... Space-time Approach to Non-Relativistic Quantum Mechanics R P Feynman The Lagrangian in Quantum Mechanics P A M Dirac 71 111 Preface Since Richard Feynman’s death in 1988 it has become increasingly ... obtain ψ(Q, t + ε) and expanding the resulting integral equation to first order in ε, Feynman obtains the Schr¨dinger equation His o derivation is valid for any Lagrangian containing at most quadratic...

Ngày tải lên: 06/11/2012, 11:21

... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern ... like to introduce some features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author ... certain (a woman of a certain age) chief (my chief complaint) Nguyễn Thị Nga K 1 1A 10 Graduation paper main (my main concern) only (the only explanation) particular (my particular aim) principle...

Ngày tải lên: 10/04/2013, 14:46

... approaches to implementing a transformation: the Sandia National Laboratories approach, a four-level transformation model that focuses on identifying a transformation trigger, and an eight-factor ... federal agencies, including the departments of Transportation, Commerce, Defense, and Homeland Security; the Federal Aviation Administrations (FAA); the National Aeronautics and Space Administration ... or staff to accept change is often rooted in a culture of inertia and bureaucratic thinking Failure or inability of an agency’s management or staff to adapt to changed conditions can also bring...

Ngày tải lên: 15/02/2014, 20:20

Ngày tải lên: 23/02/2014, 11:20

... INOPAL Investigación Operativa y asistencia técnica en planificación familiar y salud materno-infantil en América Latina y el caribe INPPARES Instituto Peruano de Paternidad Responsible IPPF International ... Non-governmental organization PHC Primary health clinic Profamila/DR Asociatión Dominicana Pro-Bienestar de la Familia/Dominican Republic RFSU Swedish Family Planning Association SAARC South Asia Association ... suffering, and are an indirect way to request assistance, as well as indicating the potential for backlash in advocacy efforts against gender-based violence 132 What Men Said about Violence against...

Ngày tải lên: 05/03/2014, 16:20

... Company Rada Mihalcea 2005 Language independent extractive summarization In AAAI’05: Proceedings of the 20th national conference on Artificial intelligence, pages 1688–1689 A Gulli and A Signorini ... New methods in automatic extracting ACM, 16(2) G Erkan and D R Radev 2004 Lexrank: Graphbased lexical centrality as salience in text summarization Journal of Artificial Intelligence Research, 22:457–479 ... syntactic and semantic relations Salton et al (1997) were among the first to make an attempt at using graphbased ranking methods in single document extractive summarization, generating similarity...

Ngày tải lên: 07/03/2014, 22:20

... (NICT), Japan A machine learning approach to hierarchical question analysis was reported in (Suzuki et al., 2003), but training and maintaining an answer extractor for question types of fine granularity ... evaluation Automatic evaluation consists of exact matching and partial matching Partial matching is useful for absorbing the variation in extraction range A partial match is judged correct if a system’s ... Daniel Marcu: A NoisyChannel Approach to Question Answering, Proc of ACL-2003, pp 16-23 (2003) Abraham Ittycheriah, Martin Franz, Wei-Jing Zhu, and Adwait Ratnaparkhi: Question Answering Using Maximum-Entropy...

Ngày tải lên: 08/03/2014, 04:22

... finding links between N1 and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer ... 719724 Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto Nagao 1998 Construction of Japanese nominal semantic dictionary using "A NO B" phrases in corpora In Proceedings ... Satoru Ikehara, Masahiro Miyazaki, Satoshi Shirai, Akio Yokoo, Hiromi Nakaiwa, Kentarou Ogura, and Yoshifumi Oyama Yoshihiko Hayashi, editors 1997 Japanese Lexicon Iwanami Publishing Information-Technology...

Ngày tải lên: 08/03/2014, 06:20

... ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example illustrates a number of instances of ... WJA ~UA (b) Figure 2a is the phonological representation for the sentence: ngarrka.ngku.ka marlu marna.kurra luwa.rnu ngarni.nja.kurra 'The man is shooting the kangaroo while it is eating grass.' ... Research Council of Canada [1] Reduplication is a word formation process involving the repetition of a word or a part of a word As an example, in Warlpiri there is a process of nominal reduplication...

Ngày tải lên: 08/03/2014, 18:20

... correspondents are enclosed in brackets They may appear as some combination of the following word-sections: a a translated initial prefix b a transliterated full or partial stem c a transliterated full ... at a time Section A determines, as far as possible at this stage, the clausal and phrasal structure within the sentence Section B is an iteration scheme for examining syntactical relations among ... ending ИЕ in the nominative singular; or An adjective, of verbal origin, belonging to a declension class which is identified by the ending ЫЙ in the masculine nominative singular This material,...

Ngày tải lên: 16/03/2014, 19:20

Ngày tải lên: 17/03/2014, 17:20

... cultivated yeast cells, and the coding region of the binding candidates was amplified by PCR using primers 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into...

Ngày tải lên: 22/03/2014, 21:20

... work badly against an adaptive adversary who can test attacks against the classifier and refine them before release Tuning heuristics can also be very difficult, in particular adjusting the false-positive ... in the attacks This will change the attack tree and add extra paths through it 25 26 A N ANALYSIS OF E - BANKING VULNERABILITIES Figure 2.4: Online banking attack tree Chapter A taxonomy of anti-phishing ... manufacturers and users to be lax about changing the default passwords Because the administration interface is nearly always web-based, this opens up some attacks As Stamm et al [30] have shown, if Javascript...

Ngày tải lên: 23/03/2014, 03:20

... regulation at the national level The Government, the Bank and the FSA are engaging in Europe and with international partners on this and other crucial issues A new approach to financial regulation 1.13 ... Financial Conduct Authority (FCA), to ensure that business across financial services and markets is conducted in a way that advances the interests of all users and participants 1.15 This is an ... crisis, and the resultant impact on the economy – globally as well as in the UK – was caused both by failures in the financial sector, and by failures in regulation of the financial sector Financial...

Ngày tải lên: 29/03/2014, 18:20