... A. -R Karala and L W Ruddock bacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections caused ... thiol–disulfide exchange enzymes, Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding ... propose that bacitracin should not be regarded as a specific inhibitor of PDI Results Bacitracin does not inhibit the catalysis of disulfide bond formation and isomerization by PDI PDI is a catalyst...
Ngày tải lên: 16/02/2014, 14:20
... phone calls and instant messages from an anonymous source began claiming that the Majestic fire was arson and part of a larger and dangerous conspiracy Thus began the "real" game, which had cleverly ... stated) and legal disclaimers All of this peripheral information serves as a constant reminder that a game is being played Another barrier to player immersion in the Nokia Game is its reliance on ... with visitor traffic and inquiries, and its owner was forced MelbourneDAC 2003 to replace his home page with a "This is not a game" disclaimer [5] As you can imagine, an audience that is quite...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc
... F(aa¯ a, aaaa) a ¯ ¯ A( a, a) F (a , aa) a ¯ A( a, a) D (a , aa) a ¯ E (a a, aaa) a ¯ ¯ D (a , aa) a ¯ C(ε, #) A (¯ , a) a ¯ D(ε, ε) F (a , aa) a ¯ A( a, a) D(ε, ε) E(¯ , a) a ¯ D(ε, ε) A (¯ , a) ... A, A , C, D, E, F}, Σ = {a, a, #}, and P consists of the following rules: S(x1 y1 , y2 x2 ) ← D(x1 , x2 ), C(y1 , y2 ) C(ε, #) ← S(aa¯ aa¯ , #¯ a aaa) a a a a D(aa¯ aa¯ , aa¯ aaa) a a ¯ a ... that MIX is not a treeadjoining language Our proof is cast in terms of the formalism of head grammar (Pollard, 1984; Roach, 1987), which is known to be equivalent to TAG (Vijay-Shanker and Weir,...
Ngày tải lên: 16/03/2014, 19:20
odysseus is not a hero
... this.Outline I) Introduction A) The average definition for a hero B) What Odysseus is like compared to the definition C) Odysseus isn¹t a hero II) Odysseus is self centered A) He doesn¹t take ... members killed at Cyclops¹ because he was being greedy.III) Odysseus is cold-hearted A) He kills people without giving them a chance 1) Suitors 2) Disloyal maids B) He doesn¹t care about people ... prevent deaths of crew membersIV) Odysseus is disloyal A) He had affairs with other women 1) Calypso 2) Circe B) Wife didn¹t betray him 1) with suitors 2) even though he was thought to be dead V)...
Ngày tải lên: 21/03/2014, 22:48
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
... for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the ... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in [T], ... pπ (a) π(b)p = pπ (a) pπ(b)p = u (a) u(b) Thus, u : A0 → B(H) is a unital ∗-homomorphism, which extends u0 , and u (A0 ) is a C ∗ -sub-algebra of B(H) It remains to note that u (A0 ) is gener1 ated, as...
Ngày tải lên: 22/03/2014, 20:20
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc
... which had happened in case of the first Bank; and the same which is liable and almost certain to happen in case of every bank which is regarded as a national or public institution, or which is ... company This edict was instantly fatal to the circulation of the notes Apart from the shock it gave to their credit, and as one edict had taken away half their value, another might take away the ... continuance It was denounced as dangerous and anti-republican, and became the subject of the sharpest party contests Pennsylvania, then, as now, was divided into a bank party and an anti-bank party,...
Ngày tải lên: 29/03/2014, 07:20
this sex which is not one
... one Take that to mean that woman does not exist, but that language That woman does not owing to the fact that language -a language-rules as master, and that she threatens-as a sort of "prediscursive ... delineate more sharply symbolic articulation that castration to effect, Lacan specifies that what is at issue as potentially lacking in castratiort is not so much the penis -a real organ-as the phallus) ... This Sex Psychoanalytic Theory: Another Look Is Not One "cloacal" eroticism constitutes an intermediate between anal eroticism and the much later eroticization of vagina the vagina is only an annex...
Ngày tải lên: 31/05/2014, 02:04
Báo cáo toán học: "A hyponormal weighted shift whose spectrum is not a spectral set " doc
Ngày tải lên: 05/08/2014, 15:20
Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx
... 14 Kawashima M, Kagami Y, Toita T, Uno T, Sugiyama M, Tamura Y, Hirota S, Fuwa N, Hashimoto M, Yoshida H, Shikama N, Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S, ... Pignon JP, MetaAnalysis of Radiotherapy in Carcinomas of Head and neck (MARCH) Collaborative Group: Hyperfractionated or accelerated radiotherapy in head and neck cancer: a meta-analysis Lancet 2006, ... 465 Kajiicho Kawaramachi Hirokoji, Kamigyo-ku, Kyoto 602-8566 Japan Department of Radiology, National Hospital Organization, Osaka National Hospital, Hoenzaka 2-1-14 Chuo-ku, Osaka city, Osaka 540-0006...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' Discussion Our results indicate that there is ... different reactions for each sample using increasing amounts of competitor DNA The amounts of sample were quantitated by extrapolating across at least three reactions in which approximately equal amounts ... numerical values Intact mRNA was successfully extracted from as little as 400 µl of whole blood, comparable amounts to that obtained from infants via heelstick This mRNA was used to quantify the amount...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx
... Hyperglycaemia has vasoconstrictive effects [22], which may aggravate tissue ischaemia, particularly in patients with obstructive vascular disease Insulin has been reported to have vasodilatory ... data collection, data analysis and writing of the manuscript JHDV participated in data analysis and writing of the manuscript JBH participated in the design of the study, data collection, data ... vascular disease such as those with acute myocardial infarction and acute stroke, and in those who have undergone cardiovascular bypass surgery and peripheral vascular surgery [12-16] Few patients...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo y học: " Minimal acupuncture is not a valid placebo control in randomised controlled trials of acupuncture: a physiologist''''s perspective" pps
... acupuncture analgesia is probably associated with its counter-regulation of spinal glial activation, PTX-sensitive Gi/o protein-mediated and MAP kinase-mediated signal pathways, and downstream ... analgesia: I: The scientific basis Anesth Analg 2008, 106:602-610 Okada K, Kawakita K: Analgesic Action of Acupuncture and Moxibustion: A Review of Unique Approaches in Japan Evid Based Complement Alternat ... networks, namely a ventral medial prefrontal cortex-paralimbic-limbic 'affective' pathway and a dorsal medial prefrontal cortex-corticalhippocampal 'cognitive' pathway [44] Limbic structures and reward...
Ngày tải lên: 13/08/2014, 15:21
A Project is Not a Black Box docx
... estimate is realized 93 a ‘Optimistic’ and ‘pessimistic’ rarely show the full probability distribution of outcomes b Sensitivity analysis changes variables one at a time, while in practice, all variables ... variables change, and the changes are often interrelated Sensitivity analysis using scenarios can help in this regard Operating leverage = a % change in operating income % change in sales For a ... other alternative courses of action has no value to the decision-maker On the other hand, the option to abandon a project has value if there is a chance that demand for a product will not meet...
Ngày tải lên: 14/08/2014, 11:20
LOOKING for a FIGHT IS THERE A Republican War on Science? potx
... Republican War on Science, journalist Chris Mooney made the case that, again and again, even overwhelming scientific consensus has met immovable political obstacles And, again and again, those obstacles ... (now-dissolved) Tobacco Institute of Australia The teaching of creationism is much less of a hot button issue in Australia than in America, partly because belief in Biblical literalism is much weaker ... this latitude was abused Rep Senator James Inhofe, the man who called the EPA a “gestapo bureaucracy” and who famously suggested that manmade global warming was “the greatest hoax ever perpetrated...
Ngày tải lên: 22/03/2014, 23:20
Is there a duty not to reproduce
... of a situation in which they are aware of the risk that ‘harm’ may arise, but they argue that the disorder is a late-onset disorder, as a consequence not manifesting itself for many years Again, ... blind and deaf The allegation was made that one doctor had acted negligently in failing to treat rubella infection Also it was claimed that another doctor had either negligently mislaid a blood sample ... that has been caused’ (Mason and McCall Smith, 1999: p 165) They comment further that, ‘This carries the practical advantage that the courts can understand and accommodate this form of damage,...
Ngày tải lên: 01/11/2013, 08:20
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... only a representative sampling from a larger number of such registrations revealed by his search Ser No 75/934,127 Applicant filed a Notice of Appeal with the Trademark Trial and Appeal Board, along ... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company sells...
Ngày tải lên: 20/12/2013, 23:15
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
... following antibodies were used: anti-ADAM10, a polyclonal rabbit antibody against endogenous ADAM10 and anti-TACE, and a polyclonal rabbit antibody against endogenous TACE (Chemikon International, ... 25–31 Takahashi, S., Kasai, K., Hatsuzawa, K., Kitamura, N., Misumi, Y., Ikehara, Y., Murakami, K & Nakayama, K (1993) A mutation of furin causes the lack of precursor-processing activity in human ... (5¢-GTGGGCCGGAAAGTGAGCCA-3¢) and Fur2_rev (5¢-CCCTTGTAGGAGATGAGGCC-3¢) The resulting 1058 bp amplificate was isolated, subcloned in pUC57 (MBI Fermentas) and sequenced Western blot analysis of TACE and ADAM10...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
... contained 30% acetonitrile and 0.006% trifluoroacetic acid Absorbance was measured at 280 nm, and the flow rate was 0.3 mL ⁄ Statistical analysis Data from three independent experimental groups are ... incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scattering assays and HPLC analysis at selected time points ThT assay To monitor peptide fibrillation, a ThT assay was ... not only a natural inhibitor of amylin aggregation, but also a contributor to the amyloid formation and pathogenesis of T2D We also found that the promotional effects were caused by coaggregation...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx
... codons for panD and aq477, they appear to be organized as an operon panD encodes an aspartate decarboxylase which catalyses the decarboxilation of aspartate to produce b-alanine, a precursor ... verify that Cys69 is required for ST activity All the activity disappeared at a : molar ratio (iodoacetamide Aq-477) This demonstrates that Cys69 is: (a) involved in the catalysis, and (b) not involved ... catalytic domain of thiosulfate cyanide sulfurtransferase (TST) which is distributed among bacteria, archaea and eukaryotes Aq-477 catalyses sulfur transfer from thiosulfate, tetrathionate and...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt
... HPNAP 1–57-up (5¢-GCGGAATTCCATATGAAAA CATTTGAAATT-3¢) and HPNAP 1–57-low (5¢-CCGCTC GAGCCTTTCAGCGA-3¢) (XhoI), and HPNAP 58–144up (5¢-GCGGAATTCCATATGATCGTTCAATTAGGA3¢) (EcoRI, NdeI) and HPNAP ... 5¢-GATCCTTTCAGCGAGATCCGCAAACATGTCCGC AAACTC-3¢ and 5¢-TTGCAGCATCCAAATGGACGCTT GCAACTTGGCCAATTG-3¢ for H2 5A, H3 7A, D5 2A and K13 4A, respectively The PCR products were purified, cloned into pET1 1a, and ... The template used was the recombinant plasmid pET1 1a ⁄ hpnap, and the primers used for the PCR were 5¢-GGTGCCTTTCACA TTCCACGCGAAGTTATGCACTTTCAT-3¢, 5¢-AATTTC TTCAGTGGCTTTCGCCACATTGAAAAAATCGGT-3¢,...
Ngày tải lên: 30/03/2014, 04:20