science as a field of research for international law

báo cáo khoa học: " Towards a data sharing Code of Conduct for international genomic research" ppt

báo cáo khoa học: " Towards a data sharing Code of Conduct for international genomic research" ppt

... sustainability and comparability Accessibility Facilitation of both the deposit of data and secure access to data are the foundations of data sharing Curators of databases should promote sharing ... greater access to and use of data in ways that are (as proposed by the joint statement by funders of health research [6]): ‘Equitable: any approach to the sharing of data should recognize and balance ... use of data Efficient: any approach to data sharing should improve the quality and value of research and increase its contribution to improving public health Approaches should be proportionate and...

Ngày tải lên: 11/08/2014, 12:21

4 279 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively ... have a great tendency to attract the attention of students that other forms of the mass media lack According to Subramaniyan A Nambiar (1985), “ Even the person who is totally tone deaf may at ... The time for the test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed...

Ngày tải lên: 29/01/2014, 10:33

39 1,1K 3
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

... Evolution of the moral sense The Taboo Blood revenge Tenures of land Classes above law Castes Privileged classes Codified laws International laws C Technology a The Utilitarian Arts.—Manufacture of ... phonology of languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons ... Subdivisions of Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica,...

Ngày tải lên: 13/02/2014, 05:20

28 666 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

... Canada and four comparison nations, 2001 Canada Overall rank Seats in parliament (%) Female legislators, senior of cials, managers (%) Female professional and technical workers (%) Ratio female:male ... (adapted from International Reform Monitors, 2002) Canada: Canada’s national health care act stipulates the provision of health care to be an entitlement However, administration of health care ... that reverse reforms associated with the welfare state International trade agreements are one way to weaken both national identities and nationally based labour unions Trade is now international, ...

Ngày tải lên: 22/03/2014, 11:20

17 843 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

... those at risk of heart failure found that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... was to compare a tango dance class, considered a novel movement intervention, with a standard community exercise class The results illustrate improvements in all measures of falls, gait and balance...

Ngày tải lên: 28/03/2014, 20:20

19 649 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

... P sub-scales, such as age, sex, marital status, educational level, religious affiliation, SpR attitude, disease and duration of disease Using the method of univariate analyses of variance we ... covariate for any of the five forms of SpR practice • Disease itself has an impact on NoP (and a minor impact on HuP and USP), while the duration of disease has no impact on the forms of SpR practice ... is an important covariate for CRP and ExP, but not for USP • Educational level is a covariate for USP and ExP • Gender andMarital status are covariates only for ExP • Age is not a relevant covariate...

Ngày tải lên: 20/06/2014, 15:20

11 425 0
báo cáo hóa học:" Depression as a predictor of work resumption following myocardial infarction (MI): a review of recent research evidence" doc

báo cáo hóa học:" Depression as a predictor of work resumption following myocardial infarction (MI): a review of recent research evidence" doc

... which assessed work resumption as an outcome measure and depression as a primary prognostic variable in cardiac patients Studies were identified using databases for medical, health, occupational and ... Enhancing Recovery in Coronary Heart Disease Patients; ACS: Acute Coronary Syndrome; CAD: Coronary Artery Disease; CABG: Coronary Artery Bypass Graft; CABS: Coronary Artery Bypass Surgery; PTCA: ... related to sampling was the lack of representativeness of female participants (one third of the studies had all male participants) For example, after a cardiac event, men have been found to have...

Ngày tải lên: 20/06/2014, 16:20

11 494 0
Báo cáo hóa học: " Research Article A Class of Commutators for Multilinear Fractional Integrals in Nonhomogeneous Spaces" pot

Báo cáo hóa học: " Research Article A Class of Commutators for Multilinear Fractional Integrals in Nonhomogeneous Spaces" pot

... multilinear singular integrals for non-doubling measures,” Journal of Mathematical Analysis and Applications, vol 327, no 1, pp 471–480, 2007 J Xu, “Boundedness in Lebesgue spaces for commutators of ... estimates for multilinear singular integrals,” e in Harmonic analysis at Mount Holyoke, vol 320 of Contemporary Mathematics, pp 323–331, American Mathematical Society, Providence, RI, USA, 2003 ... Chen and E Sawyer, A note on commutators of fractional integrals with RBMO μ functions,” Illinois Journal of Mathematics, vol 46, no 4, pp 1287–1298, 2002 J Garc a- Cuerva and J Mar a- Martell,...

Ngày tải lên: 22/06/2014, 02:20

17 203 0
Báo cáo hóa học: "Research Article Weighted Estimates of a Measure of Noncompactness for Maximal and Potential Operators" pot

Báo cáo hóa học: "Research Article Weighted Estimates of a Measure of Noncompactness for Maximal and Potential Operators" pot

... 34, page that the measure of noncompactness of T is greater than or equal to limn → ∞ en T In the sequel, we assume that X is a Banach space which is a certain subset of all Haarmeasurable functions ... some classical operators,” Acta Mathematica Sinica, vol 22, no 6, pp 1847–1862, 2006 D E Edmunds and A Meskhi, “On a measure of non-compactness for maximal operators,” Mathematische Nachrichten, ... T Sawyer, A characterization of a two-weight norm inequality for maximal operators,” Studia Mathematica, vol 75, no 1, pp 1–11, 1982 21 E T Sawyer, A two weight weak type inequality for fractional...

Ngày tải lên: 22/06/2014, 03:20

19 210 0
báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc

báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc

... larger datasets and results of ongoing adjuvant trials are needed to provide confirmatory evidence for or against the concept and feasibility of withdrawal therapy in locally advanced and metastatic ... Segaloff A, Rubens RD: Assessment of response to therapy in advanced breast cancer: a project of the Programme on Clinical Oncology of the International Union Against Cancer, Geneva, Switzerland Cancer ... breastinternationalgroup.org/LinkClick.aspx?fileticket=dmcZc0avwBc% 3d&tabid=2341] doi:10.1186/1477-7819-9-101 Cite this article as: Agrawal et al.: Clinical relevance of “withdrawal therapy” as...

Ngày tải lên: 09/08/2014, 02:21

4 254 0
Báo cáo khoa học: " Intensity modulated radiotherapy for localized prostate cancer: rigid compliance to dose-volume constraints as a warranty of acceptable toxicity?" pptx

Báo cáo khoa học: " Intensity modulated radiotherapy for localized prostate cancer: rigid compliance to dose-volume constraints as a warranty of acceptable toxicity?" pptx

... year were considered evaluable to acute and late toxicity analysis, as they were staged as with localized disease and treated with IMRT as a sole treatment, or in adjuvant manner, after surgical ... patients (1.6%, a case of diarrhea requiring parenteral support and a case of severe blood discharge necessitating sanitary pads), and acute Grade GU toxicity occurred in patients (2.4%, all of ... the prostatic bed Data regarding patient clinical and staging characteristics are shown on Table At admission, all patients had a positive histologic diagnosis of prostate cancer, graded according...

Ngày tải lên: 09/08/2014, 10:21

7 418 0
Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx

Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx

... proximal by partial clamping of the aorta (for the cases with more than one graft) After completion of the proximal anastomoses the extracorporeal circulation is interrupted and hemostasis is performed ... beat empty of volume The last part of the operation is carried out using an off pump coronary artery bypass (OPCAB) stabilizer in order to perform the necessary distal coronary anastomoses and ... anterior and apical ruptures which are the majority of the ruptures representing 60-80% of all cases [3], and finally ι) it allows seasonably control and correction of Apostolakis et al Journal of Cardiothoracic...

Ngày tải lên: 10/08/2014, 10:20

4 370 0
báo cáo khoa học: " Translating research into practice in Leeds and Bradford (TRiPLaB): a protocol for a programme of research" ppsx

báo cáo khoa học: " Translating research into practice in Leeds and Bradford (TRiPLaB): a protocol for a programme of research" ppsx

... area of child and maternal health care with a range of commissioners and practitioners revealed the importance of maternal mental health as a focus for activity The conjoint survey will reveal ... we are working with NHS Bradford and Airedale (an NHS commissioning and community provider organisation) to translate research- based findings into practice in the areas of maternal mental health ... exploration will form our 'diagnostic analysis' [3] of the local context in each of the NHS healthcare organisations that make up our case study series Page of Methods Ethical approval for this...

Ngày tải lên: 10/08/2014, 10:22

6 230 0
Báo cáo y học: "Threshold for detection of diabetic peripheral sensory neuropathy using a range of research grade monofilaments in persons with Type 2 diabetes mellitu" pot

Báo cáo y học: "Threshold for detection of diabetic peripheral sensory neuropathy using a range of research grade monofilaments in persons with Type 2 diabetes mellitu" pot

... test was clearly explained to the participant, and a monofilament was demonstrated on the inside of the investigator's forearm and then repeated at the same site on the participant They were asked ... recruited for the study by convenience sampling and all were Caucasian except one South Asian As indicated in Table 2, there was a group of 80 persons with Type DM diagnosed for less than two years ... that perception of a monofilament of approximately 2grams placed a person within the normal range whereas http://www.jfootankleres.com/content/1/1/9 another [6] used a 5-gram monofilament as...

Ngày tải lên: 10/08/2014, 21:23

7 309 0
Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx

Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx

... than a month She began having regular menstrual cycles again, and was able to maintain her weight at an appropriate level One year after discharge from the hospital, her weight was 53 kg, and ... tomography; DSM IV: Diagnostic and Statistical Manual of Mental Disorders, 4th Edition; GI: gastrointestinal; MRI/MRA: magnetic resonance imaging/ arteriography; NG: nasogastric tube; NJ: nasojejunal ... challenging: SMA syndrome can precipitate and exacerbate anorexia nervosa because of the nausea associated with a small bowel obstruction and conversely, anorexia nervosa prevents the patient from...

Ngày tải lên: 11/08/2014, 17:21

5 312 0
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

... Cariparma (Cassa di Risparmio di Parma, Italy) for funding contributions to the project Author details Department of Human Anatomy and Physiology, University of Padova, Italy Department of Neuroscience, ... University of Padova, Italy 3Department of Pharmaceutical Sciences, University of Parma, Italy 4Department of Animal Health, University of Parma, Italy Authors’ contributions RM: performed the ... cord of a cow with astasia Archives of virology 2000, 145(11):2363-2370 Redaelli M, Cavaggioni A, Mucignat-Caretta C, Cavirani S, Caretta A, Donofrio G: Transduction of the rat brain by Bovine Herpesvirus...

Ngày tải lên: 12/08/2014, 02:20

6 232 0
Báo cáo y học: "Protein C as a surrogate end-point for clinical trials of sepsis" docx

Báo cáo y học: "Protein C as a surrogate end-point for clinical trials of sepsis" docx

... Statistical validation of intermediate endpoints for chronic diseases Stat Med 1992, 11:167-178 Vasan RS: Biomarkers of cardiovascular disease: molecular basis and practical considerations Circulation 2006, ... encainide and flecainide on mortality in a randomized trial of arrhythmia suppression after myocardial infarction N Engl J Med 1989, 321:406-412 Freedman LS, Graubard BI, Schatzkin A: Statistical validation ... greater treatment benefit was observed The cohort was divided into groups with a higher and lower risk for death, based on the baseline biomarker cut-off levels The relative risk for death was...

Ngày tải lên: 13/08/2014, 10:20

2 222 0
Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot

Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot

... external gag-specific primers (1386-5': GAAACTATGCCAAAAACAAGT and 2129-5': TAATCTAGCCTTCTGTCCTGG) and two internal gag-specific primers (1731N 5': CCGTCAGGATCAGATATTGCAGGAA and 2042C 5': CACTAGCTTGCAATCTGGGTT), ... days Evaluation of the transduction rate DNA was extracted from macaque PBMCs and the amount used for each sample was normalized based on data for amplification of the β-globin gene, using 5'ACCATGGTGCTGTCTCCTGC-3' ... by a quantitative PCR method based on the specific amplification of the SIV gag gene (C) Plasma viral load was estimated by a quantitative branched-DNA method based on the specific amplification...

Ngày tải lên: 13/08/2014, 13:20

11 256 0
w