sar of the • epoxide region of fragment a

Tài liệu Báo cáo khoa học: The intracellular region of the Notch ligand Jagged-1 gains partial structure upon binding to synthetic membranes docx

Tài liệu Báo cáo khoa học: The intracellular region of the Notch ligand Jagged-1 gains partial structure upon binding to synthetic membranes docx

... occurs The identification of post-translational modifications that can play a role in the function and structure of Jagged-1 cytoplasmic tail, as well as the identification of binding partners at the ... mm) at pH 7.4 and at pH Fig S9 Intrinsic disorder Domain architecture, as calculated by SMART, of human RIP substrates analyzed in this work This material is available as part of the online article ... as in the methyl region (data not shown) is an indicator of the lack of globular structure, and of little, if any, secondary structure [15] The presence of strong and sharp resonances accompanied...

Ngày tải lên: 18/02/2014, 16:20

12 502 0
Tài liệu Market Analysis of Hydroponic Lettuce in the Nashville Region pdf

Tài liệu Market Analysis of Hydroponic Lettuce in the Nashville Region pdf

... the Real Yellow Pages were used to gather restaurant information The restaurant listing had 2309 restaurants from the Nashville area The number of restaurant types was narrowed down by categories ... had moved to another locations For others, the manager was not available Of the 43% that responded to the survey,73% of those respondents were market participants for head lettuce Of the restaurants ... restaurants per day The survey also demonstrated that most of the restaurants used a local wholesaler for their supply of fresh lettuce Based on the results of the first survey, the market analysis...

Ngày tải lên: 21/02/2014, 08:20

32 588 0
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

... of beads with bound chromatin’ was calculated This value was used as an index of the affinity of beads bearing LBR fragments and chromatin The values shown in the figures are the averages of three ... that a kinase(s) in the synthetic phase egg cytosol fraction phosphorylates NK at a functionally similar site(s) to in the case of PKA, and thereby increases the affinity of LBR and chromatin The ... For other details, see Materials and methods Fig N-Terminal fragments of LBR expressed as GST fusion proteins, and the binding of beads bearing these fragments to chromatin (A) Schematic diagrams...

Ngày tải lên: 22/02/2014, 04:20

11 563 0
Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

... substrate for uPA The amount of active PAI-1, and thus the specific inhibitory activity, was calculated from the total amount of PAI-1 that had to be present to inhibit half of the uPA activity in the ... described above, and the functional half-lives of the variants were calculated Analysis of functional behaviour of PAI-1 by reaction with low Mr uPA (LMW-uPA) and SDS/PAGE Other proteins and miscellaneous ... AB) All other chemicals and reagents were of the highest quality commercially available Activation of latent PAI-1 Unless otherwise indicated, latent PAI-1 was converted to the active conformation...

Ngày tải lên: 22/02/2014, 07:20

10 431 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB Analysis of mAbs binding to the recombinant FnBR indicated the generation ... Biorad) was also used to dilute the analyte All of the assays were performed at 25 °C The sensorgrams (time course of the SPR signal in RU) were normalized to a baseline value of All sensorgram ... parallel) at a rate of 30 lLÆmin)1 for (association phase) The dissociation phase was evaluated during the following 10 The vehicle was always injected in parallel-flow channels The running buffer, NaCl...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...

Ngày tải lên: 08/03/2014, 09:20

6 387 0
Protection against South American leaf blight of rubber in Asia and the Pacific region pptx

Protection against South American leaf blight of rubber in Asia and the Pacific region pptx

... Indonesia, Viet Nam, Sri Lanka, Malaysia, southern part of India, tropical part of China, part of Lao PDR, Myanmar, Bangladesh, Brunei, Cambodia, the Philippines and Papua New Guinea 25 The major ... including the use of integrated pest management, as appropriate, eradication and the establishment of Pest free areas and areas of low pest prevalence and the application of phytosanitary measures ... many of the epidemiological characteristics of SALB and the causal organism, the following risk analysis has been undertaken using qualitative rather than quantitative values Table describes these...

Ngày tải lên: 08/03/2014, 10:20

112 560 0
Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf

Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf

... buildings and facilities in all schools Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St Kitts & Nevis St Lucia St Vincent & Grenadines Trinidad & Tobago Table Education ... society organizations and others In six countries, namely the Bahamas, Barbados, Grenada, Guyana, Jamaica and Trinidad and Tobago, support is given to a Sector Wide Approach (SWAP) in education with ... or a separate HIV unit within the MoE In the case of Belize, an HFLE unit in the MoE addresses SHN-and HIV-related activities Orphans and Vulnerable Children Anguilla Antigua The Bahamas Barbados...

Ngày tải lên: 14/03/2014, 20:20

40 451 0
Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

... )1219G >A and )32C >A) showed a highly significant effect for the haplotype defined by the )3 2A allele and also a moderate effect for the )121 9A allele Another questionable mechanism for the lack of association ... Wang HH & Chiang AN (2004) Cloning and characterization of the human beta2-glycoprotein I (beta2-GPI) gene promoter: roles of the atypical TATA box and hepatic nuclear factor-1alpha in regulating ... with a mean value of 20 mgÆdL)1 in the White population and 15 mgÆdL)1 in African Americans [12], which may have clinical relevance in b2GPIrelated pathways Family and heritability data have provided...

Ngày tải lên: 15/03/2014, 10:20

13 404 0
Báo cáo khoa học: Probing the unfolding region of ribonuclease A by site-directed mutagenesis potx

Báo cáo khoa học: Probing the unfolding region of ribonuclease A by site-directed mutagenesis potx

... CGG AAT GCC ACC AAA GAT CGA TGC AAG C-3Â rev 5Â-G CTT GCA TCG ATC TTT GGT GGC ATT CCG GCT CTT CAT CAT C-3Â fw 5Â-G ATG ATG AAG AGC CGG AAT TCC ACC AAA GAT CGA TGC AAG C-3Â rev 5Â-G CTT GCA TCG ATC ... 6-FAM-dArU(dA)2-6-TAMRA as substrate [23], revealed that all RNase A variants are active (Table 3) However, while the RNase A variants with mutations in the Ala20 loop region as well as N34DRNase A and ... TCC AGC ACT TCC GCC GCC CTG AGC TCC AAC TAC TG3Â rev 5Â-CA GTA GTT GGA GCT CAG GGC GGC GGA AGT GCT GGA G-3Â fw 5Â-C CAG ATG ATG AAG AGC CGG GAC CTG ACC AAA GAT CGA TGC-3Â rev 5Â-GCA TCG ATC TTT...

Ngày tải lên: 16/03/2014, 18:20

10 491 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

... mRNA was analysed by agarose gel electrophoresis and autoradiography (C) Polyadenylated IFN-b mRNA AU+ was transcribed from the pBSIFNpA The poly (A) – IFN-b mRNAs, AU+pA– and AU–pA–, were transcribed ... residues was generated by in vitro transcription in the presence of 32P-labelled UTP (see Materials and Fig Deadenylation of IFN-b mRNA is independent of translation (A) Deadenylation analysis of the ... of both the ARE and the CRID (Fig 3) The CRID was identified previously as an instability determinant that, in combination with the 3¢UTR, mediates the rapid decay of human Fig Deadenylation of...

Ngày tải lên: 17/03/2014, 10:20

8 361 0
Báo cáo Y học: The inhibitory region of troponin-I alters the ability of F-actin to interact with different segments of myosin pot

Báo cáo Y học: The inhibitory region of troponin-I alters the ability of F-actin to interact with different segments of myosin pot

... AKETLDLRAHLKQVKKEDTEK AKESLDLRAHLKQVKKEDTEK GLCHPRVKVGNEYVTKG APKKDVKKPAAAAAAPAPAPAPAPAPAKPKEEKIDL APKKDVKKPAAAA PKYVKQATLKLAT Ó FEBS 2002 5090 V B Patchell et al (Eur J Biochem 269) a stock ... observations and the fact that only about half of the residues of the IP are required for inhibitory activity suggest that the interaction of only a small region of TnI with the N-terminal region of actin ... Sensorgrams were analysed using BIAEVALUA TION software taking account of the small amount of nonspecific binding of the TnI peptide to the control surfaces The association and dissociation rate constants...

Ngày tải lên: 17/03/2014, 10:20

13 524 0
Spatial-temporal Dynamics of Rubber Plantation in the Border Region of China, Laos and Myanmar: 1980-2010 pdf

Spatial-temporal Dynamics of Rubber Plantation in the Border Region of China, Laos and Myanmar: 1980-2010 pdf

... plantations has been expanded to the areas of higher elevations and steeper slopes in China There are considerable suitable land for rubber plantation in Laos and Myanmar A reasonable planning ... raise profit at least negative ecological impacts - Rubber plantations in the border region of China, Laos and Myanmar Thanks for Your Attention Contact Information:  Luguang Jiang, PhD, Associate ... increased The expansion of rubber plantations mainly occurred between 15° and 35° and gradually extended in steep and abrupt slopes The planted intensity of rubber plantations gradually increased...

Ngày tải lên: 23/03/2014, 21:21

21 477 0
the dialects and culture of the kinki region - kinki japanese

the dialects and culture of the kinki region - kinki japanese

... tei al e aa r e DIALECT LOCATION aaah あかな しょ W k y m knso aaaa STANDARD K N A - E A S I B N E G I H N L S aa あかん kn n go o od dndnでんでん e-e Wkym aaaa znzn全然 e-e nt t l o al a dr デロ eo Wkym aaaa ... olwn: yr ao yn a yna ak ytaa atr や やろ ゃん ゃんか ゃったら rpae dr elcs a6 rpaejni elcs aa rpaejni a elcs aa k rpae dtaa elcs atr だろう じゃない じゃないか だ、ったら Y n t aitosa rubytem s r i ldfeec n aa di rain r gal h ... o a u o ht aa aept n or a Hnhn ies aeal a n lan o pa l e n i asi Tgr bsbl cp a d er t sek i a a v k te Gnat n! abte a ITOUTO NRDCIN ・ 1 W a IKni h ts ik? T eKnirgo f aa ,aldKniC i o近畿地方in aaee...

Ngày tải lên: 27/03/2014, 12:26

173 444 0
Báo cáo khoa học: Functional role of the linker region in purified human P-glycoprotein pot

Báo cáo khoa học: Functional role of the linker region in purified human P-glycoprotein pot

... 4.7 (Table 2) Thus, the linker region appears to suppress the basal ATPase activity rather than the substrate-stimulated ATPase activity The ksub kbasal values of the half-size ABC transporters, ... cleavage generated a 56 kDa fragment As P-gp cleavage proceeded, the verapamil-stimulated ATPase activity gradually increased to a maximum of 340% within 105 The increase in verapamil-stimulated ... substrate-stimulated ATPase activity [33] (ii) Size-exclusion chromatography analysis indicated that the N-half and C-half fragments of P-gp are neither aggregated nor dissociated by cleavage of the...

Ngày tải lên: 29/03/2014, 23:20

13 313 0
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot

Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot

... GATCGCTAGCGTGTGATGAAGGCGGAGCAACAGCAGGAAGAC GATCGCTAGCGTGTGATGAAGGCGGAAGATGTAAAAGGTG GATCGAATTCTGGAAGATGTAAAAGGTG GATCGTCGACATCCAGTCAGTCGTCTATAC GATCCTCGAGATCCAGTCAGTCGTCTATAC GATCGAATTCACAGAAGACATGA, ... GATCGAATTCTTTGTCTGTGACCCAGATGC GATCGGATCCTTAGAGGGCATCTGGGTCACAG GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC GATCGAATTCGAGAGACTGGAAGGCAAAG ... GATCGAATTCTGCACAAGGTTCTGAACCA, GATCGAATTCTGAGCGACATGAAGGCGGAC, GATCGAATTCTAGCGGACGTGACCCGCCTG, GATCGAATTCCCATCGCAGCCCGCCTTCAGATG, GATCGAATTCTCAGCCGGCTGGCCAGCA, GATCGAATTCCTCACCCCACACCGGCCTAC, GATCGAATTCCCTACGCTACACCTCCG,...

Ngày tải lên: 30/03/2014, 09:20

15 324 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot

Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot

... C, Ali-Madadi K, Riazalhosseini Y, Yazdan H, Arzhangi S, Jalalvand K, Ebrahimi A, Kazemi S, Smith RJ, Najmabadi H: The frequency of GJB2 mutations and the Delta (GJB6-D13S1830) deletion as a cause ... Oliveira CA, Azaiez H, Brownstein Z, Avenarius MR, Marlin S, Pandya A, Shahin H, Siemering KR, Weil D, Wuyts W, Aguirre LA, Martín Y, MorenoPelayo MA, Villamar M, Avraham KB, Dahl H-HM, Kanaan M, Nance ... profound bilateral sensorineural hearing impairment on audiograms Careful medical examinations revealed no clinical features other than hearing impairment DNA was extracted from the peripheral...

Ngày tải lên: 18/06/2014, 16:20

7 695 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

... led the analysis of the trainer data, as well as contributed to the literature review and writing the article DB participated in the analysis of the trainer data, as well as contributed to the ... region A strong sense of leadership within the new cadre of VCT advanced and master trainers was another critical factor in the program's success This encouraged collaboration and Page of (page ... that made this project and the evaluations possible Special thanks go to Petula Lee (Jhpiego), who managed the VCT training program from the Caribbean; and to Barbara McGaw (The Caribbean HIV/AIDS...

Ngày tải lên: 18/06/2014, 17:20

8 450 0
Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from ... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAACCTC EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA ... from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC AGGAAAAAAATTTAAATGAGTTAGCCTCCCCCATC AGGAAAAAATTCGAATCAGTTAGCCTCCCCCATC plasmid was then used to replace the E3 region by the CMVp and TCS, in pTG3622,...

Ngày tải lên: 20/06/2014, 01:20

4 451 0
báo cáo hóa học:" Endometriosis-associated ovarian cancer: A tenyear cohort study of women living in the Estrie Region of Quebec, Canada" doc

báo cáo hóa học:" Endometriosis-associated ovarian cancer: A tenyear cohort study of women living in the Estrie Region of Quebec, Canada" doc

... questions Acknowledgements We thank Hassan Diab (CIRESSS), Nathalie Carrier and Krystel Paris for their assistance with data management and statistical analysis Authors’ contributions AA: Professor, ... 000 Aris Journal of Ovarian Research 2010, 3:2 http://www.ovarianresearch.com/content/3/1/2 Page of Table Groups of endometriosis-associated ovarian cancer (EAOC) and ovarian cancer (OC), according ... Mean age of women with endometriosisassociated ovarian cancer (EAOC) was 48.3 ± 10.8 (Table 1) Furthermore, data after Tukey adjustment showed that mean (± SE) difference of age at ovarian cancer...

Ngày tải lên: 20/06/2014, 07:20

5 429 0
w