sage+michael+r+loebinger+and+sam+m+janes

... lower chamber for hours Nonmigrated cells from the upper chamber and migrated cells from the lower chamber were cultured with M- CSF and RANKL to form osteoclasts TRAP staining was formed Bar graphs, ... and Gr-1 proteins, cell surface markers for OCPs [20], with primary bone marrow mononuclear cells isolated from the same mice As we reported previously [20], more than 10% of primary bone marrow ... arthritis may therefore be to reduce bone marrow SDF-1 concentrations Materials and methods Reagents and animals Recombinant murine SDF-1, TNFα, and RANKL were from R& D Systems (Minneapolis, MN,...

Ngày tải lên: 09/08/2014, 10:23

... Abnormal networks of immune responserelated molecules in bone marrow cells from patients with rheumatoid arthritis as revealed by DNA microarray analysis Arthritis Research & Therapy 2011 13 :R8 9 ... Salazosulfapyridine 1000 mg/day, MTX mg/week MTX mg/week 17 40 2.9 MTX mg/week CRP, C-reactive protein; DMARDs, disease-modifying antirheumatic drugs; MTX, methotrexate; RA, rheumatoid arthritis; RF, rheumatoid ... combine DNA microarray with bioinformatics for describing gene expression profiles from RA BM cells and for revealing abnormal networks involving immune response- and cell cycle-related molecules...

Ngày tải lên: 12/08/2014, 17:21

... gnitsevrah yb denimreted saw sCD fo noitroporp ehT syad rof FSC-MG esuom tnanibmocer lm/gn 01 fo ecneserp eht ni derutluc erew sMB detsevrah ehT srumef morf DS ± naem eht dna ecim detaidarri ro detaidarri-non ... dasarP ,R ramuK ,A amrahS ,R ragaS ,R alwahC ,D atpuG ,R arorA 54-73 ,63 ,6002 lonummI J ruE slangis yrotammalfni detaidem-rotpecer ekil-lloT gnitibihni yb sispes latnemirepxe ot ecnatsiser secudni ... ecnadrocca ni demrofrep erew stnemirepxe lamina ehT stnemirepxe eht rof desu erew ecim elamef dlo-keew 21 ot -7 ytilicaf lamina yrotarobal eht ni deniatniam dna )aeroK( OIB tneirO morf desahcrup...

Ngày tải lên: 07/08/2014, 20:23

... co-culture The culture medium was RPMI 1640 medium containing 10% FBS, 0.1 mM non-essential amino acid, mM sodium pyruvate, mM L-glutamine, 100 IU/ml penicillin/ streptomycin, and 50 M 2-mercaptoethanol ... BMCs were harvested from the femurs and tibias of mice of C57BL/6 mice as described in previous report [9] Any contaminated red blood cells were eliminated by ammonium chloride-potassium carbonate ... fucoidan-treated BMCs compared to control BMCs and increased the production of TNF-alpha in fucoidan-treated BMCs and fucoidan-treated irradiated BMCs compared to control BMCs and irraditated BMCs respectively...

Ngày tải lên: 07/08/2014, 23:22

... measurements For the cartilage defect area, the measurement points were the center and four points at mm above, below, left, and right of the center The percentage maximum magnitude (the maximum magnitude ... of articular cartilage [13] (upper) and a wavelet map (lower) are shown on the right The maximum magnitude is indicated by the gray scale and the percentage maximum magnitude (the maximum magnitude ... Arthritis Research & Therapy Vol No Hattori et al treatment of cartilage defects Furthermore, the length of time required for chondrocyte maturation or stem cell differentiation into...

Ngày tải lên: 09/08/2014, 06:22

... leukemia Moreover, replication-competent retrovirus (RCRs), recombinant retrovirus and interaction with endogenous retroviruses Page 12 of 15 (page number not for citation purposes) Retrovirology ... quantitative real-time PCR on 250 ng of DNA run on an iCycler real-time thermocycler (Bio-Rad, California, USA) Primers were as follows: forward primer, 5'ACGACGGCAACTACAAGACC3'; reverse primer, 5'GCCATGATATAGACGTTGTGG3' ... shown are the mean values for the three monkeys, each studied in triplicate mals from groups and were studied from days -1 to 471 after gamma irradiation Controls were followed over the same period...

Ngày tải lên: 13/08/2014, 05:21

... into the nanostructure and force feature of immature and mature DCs Materials and methods Preparation of bone marrow cells Bone marrow-derived dendritic cells were generated according to Lutz’s ... curves were recorded for every cell (n = 10 cells for each group) All force-distance curve experiments were performed at the same loading rate The root-mean-square (rms) roughness and average roughness ... surface imaged in air were calculated using the AFM The rms roughness (Rrms or Rq) and average roughness (Ra ) were defined by formulas below: N Rrms = Ra = N Page of growth under a light microscope...

Ngày tải lên: 21/06/2014, 02:20

... angiogenesis and improve heart function in rat model of myocardial ischemia with reperfusion Eur J Cardiothorac Surg 2006, 30:353-61 Zimmet JM, Hare JM: Emerging role for bone marrow derived mesenchymal ... ischemic muscle regions were significantly reduced after simvastatin and bone marrow-derived MSCs combined treatment Therefore, our study clearly demonstrated that bone marrow-derived MSCs in combination ... September 2010 References Diehm C, Allenberg JR, Pittrow D, Mahn M, Tepohl G, Haberl RL, Darius H, Burghaus I, Trampisch HJ: Mortality and vascular morbidity in older adults with asymptomatic versus...

Ngày tải lên: 10/08/2014, 05:21

... alcohols and mounted with Entellan (Merck KGaA, Darmstadt, Germany, http://www.merck.de) Samples were observed by light microscopy 2.5 Immunocytochemistry For immunofluorescence, MSCs were grown and ... collaboration with members of our laboratory, Louise Moraes and Wagner Monteiro Cintra) Since protamine is clinically approved and does not alter proliferation rate, we performed a more extensive ... MRI coils are too small to accommodate rats All other experiments were performed on rats 2.1 Isolation and Cultivation of Rat/Mouse Mesenchymal Cells from Bone Marrow To obtain bone marrow cells,...

Ngày tải lên: 11/08/2014, 00:22

Ngày tải lên: 11/08/2014, 00:23

... for 10 min, and viruses were harvested from the supernatant Viruses were purified by cesium chloride density gradient centrifugation, and virus titer was determined after the formation of virus ... liver, and normal and necrotic femoral heads of rabbits with MSC transplantation were observed under fluorescence and light microscope Results revealed the amount of MSCs in the necrotic femoral ... human bone marrow-derived stromal progenitor cells (mesenchymal progenitor cells): implications for therapeutic use Bone Marrow Transplant,1995,16(4):557-564 Aggarwal S, Pittenger MF Human mesenchymal...

Ngày tải lên: 25/10/2012, 11:18

... enlargement [29] Furthermore, we have observed that the protein patterns from samples from bone marrow and peripheral blood from the same patient show a high correlation The observed changes are ... 1, and mg/ml was used Control material from Boehringer Mannheim (Precinorm protein control serum) was used to obtain the standard curves that were run with each determination First dimension ... with AML collected from two compartments, bone marrow and peripheral blood We previously used a cell culture model derived from thermoresistant gastric cancer to build up a database for 2Delectrophoresis...

Ngày tải lên: 18/06/2014, 15:20

... inserted into a dedicated reader and 25 μL of the prepared sample are dispensed into the four reservoirs The reader draws, mixes and incubates the sample with the various reagents at programmed ... Culture insert with an m pore size PET membrane, uniformly coated with Matrigel Matrix The matrix provides a barrier to non-invasive cells while presenting an appropriate protein structure for invading ... Vogl TJ, Martin H, Schächinger V, Dimmeler S, Zeiher AM: Infarct remodeling after intracoronary progenitor cell treatment in patients with acute myocardial infarction (TOPCARE-AMI): mechanistic...

Ngày tải lên: 18/06/2014, 15:20

... Muller JH, Weng Y, Meyer R, Dandel M: Bridging-to-recovery Ann Thorac Surg 2001, 71:S109-113 Simon MA, Kormos RL, Murali S, Nair P, Hefernan M, Gorcsan J, Winowich S, McNamara DM: Myocardial recovery ... failing myocardium Curr Opin Cardiol 2008, 23:206-218 Jahanyar J, Youker KA, Torre-Amione G, Koerner MM, Bruckner B, Noon GP, Loebe M: Increased expression of stem cell factor and its receptor after ... an implantable cardio-defibrillator and dual chamber pacemaker with additional wire for cardiac resynchronisation therapy There are drug eluting stents in the left coronary artery Bone marrow...

Ngày tải lên: 18/06/2014, 16:20

... for tissue engineering applications Bone marrow stromal cells (MSCs) are multipotent stem cells originating from the bone marrow stroma, and represent a particularly promising cell source for ... literature reports that cell number and attachment force were increased on textured polymer substrates [26,28,29] Furthermore HA is a well known sorbent for molecules Involvement of HA particles ... dexamethasone Endocrinology 1994, 134:277-286 Mikos AG, Sarakinos G, Vacanti JP, Langer RS, Cima LG: Biocompatible polymer membranes and methods of preparation of three dimensional membrane structures...

Ngày tải lên: 20/06/2014, 01:20

... synovial membrane, the SLIM arises directly from progenitor cells in the bone marrow Thus, PLFs probably originate directly from mesenchymal stem cells in the bone marrow and thereby render APL ... pattern of membrane-type matrix metalloproteinases in rheumatoid arthritis Arthritis Rheum 2000, 43:1226-1232 Bertolini DR, Nedwin GE, Bringman TS, Smith DD, Mundy GR: Stimulation of bone resorption ... human recombinant tumour necrosis factor (TNF)-α (at a concentration between and 300 ng/ml; Roche Biochemicals, Basel, Switzerland), ionomycin (10 µg/ml; Biomol, Hamburg, Germany) or control medium...

Ngày tải lên: 09/08/2014, 01:21

... another area within the medial tibiofemoral compartment not affected by BML, and from the lateral tibiofemoral compartment as well as from matched locations from the lateral compartment Core length ... study participant plateau (arrow) (b) Regions from the BML area, from another area within the medial tibiofemoral compartment not affected by BMLs, and from the lateral tibiofemoral compartment ... by BMLs and bone medial (or lateral) regions unaffected by BMLs as well as from control regions from the lateral (or medial) tibial plateau In order to compare histomorphometric parameters and...

Ngày tải lên: 09/08/2014, 01:22

... error of the mean One representative experiment out of six different samples of bone marrow mesenchymal stem cells (three normal, two osteoarthritis and one rheumatoid arthritis) and synovium mesenchymal ... characterization of rheumatoid arthritis synovial fibroblasts from primary culture – primary culture cells markedly differ from fourth-passage cells Arthritis Res 2001, 3:72-76 Le Blanc K, Tammik ... expression, and the results are reported as ratios of the marker gene versus GAPDH using the formulae 2-∆Ct (×100) ± standard error of the mean Statistics compared eight cell samples from BM and...

Ngày tải lên: 09/08/2014, 07:20

... http://arthritis-research.com/content/8/2 /R5 4 Figure The correlation of the expression of mRNAs for nuclear factor (NF)κB1 (CRP) mRNA in bone marrow CD34+ cells with serum C-reactive protein mRNA in bone marrow CD34+ cells with serum ... factor (NF)κB1 mRNA in bone marrow CD34+ cells from patients with rheumatoid arthritis Purified bone marrow CD34+ cells were transfected with small interfering RNA (siRNA) for NFκB1 or a scrambled ... (NF)κB1 mRNA in bone marrow CD34+ cells from patients with rheumatoid arthritis Purified bone marrow CD34+ cells from 12 patients with rheumatoid arthritis were transfected with small interfering RNA...

Ngày tải lên: 09/08/2014, 07:20