... of dikes and revetments failed and breached induced by variety of failure modes This caused flooding in the wide area along Namdinh coastline and as the consequence, it leaded to loss of land, ... cultivated land Practical statistics showed that 38,273 cultivated land was impacted by salt, and 76,474 tons of food was lost Salt mining fields, and shrimp hatching ponds were also heavily damaged ... flat reached at certain depth, the dikes were damaged and destroyed Safety Assessment of Sea Dikes In Vietnam A Case Study In Namdinh Province 36 Chapter Possible failure mechanisms of Namdinh...
Ngày tải lên: 03/10/2014, 13:14
... ducks) animals were placed in the same cage at DPI Tracheal swabs were collected on daily basis and were maintained in BHI media and were directly used to RNA extractions Non-inoculated negative ... RRT-PCR as described above and a standard curve was established 5.7 Sequence analysis and molecular graphic visualization The HA1 and NA genes of the A/ turkey/Ohio/313053/04 virus were amplified from ... more days Peak day of virus detection Estimated average virus titer on peak day/ml No of animals seroconverted /total inoculated HI*** average titer at 14DPI Virus isolation from swab samples A/ TK/IL/04...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Research Article Relations between Limit-Point and Dirichlet Properties of Second-Order Difference Operators A. Delil" pdf
... throughout: R and C denote the real and complex number fields, and N is the set of nonnegative integers z denotes the complex conjugate of z ∈ C (·) and (·) represent the imaginary and real part of a complex ... would like to obtain some implications additional to Corollary 2.4 by imposing conditions on p, q, and w which are as weak as possible The motivation of the problem and parts (a) and (b) of the ... 447–486, 1982 [6] D B Hinton and R T Lewis, “Spectral analysis of second order difference equations,” Journal of Mathematical Analysis and Applications, vol 63, no 2, pp 421–438, 1978 A Delil 15 [7]...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo y học: "Mating rhythms of Drosophila: rescue of tim01 mutants by D. ananassae timeless'''' pdf
... times of the day Interestingly, the mating rhythm of D ananassae under DD differed from the mating rhythms of D melanogaster and D simulans (Fig 2A and [2]) Most D ananassae flies mated during ... melanogaster Canton-S males and in D ananassae HW females crossed with D ananassae HW males (B) Mating activities in transgenic w, tim01, hs -D ananassae tim flies that were heat shocked every day at ... P-element-mediated methods as described by Nishinokubi et al [9] Mating activity assays Virgin female and male flies maintained as described above for days after eclosion were transferred to DD conditions...
Ngày tải lên: 10/08/2014, 09:20
The sociology and psychology of terrorism who become a terrorist anh why
... case.” Mentally unbalanced individuals have been especially attracted to airplane hijacking David G Hubbard (1971) conducted a psychiatric study of airplane hijackers in 1971 and concluded that ... measures Even then, an individual wanting to hijack an airplane can often find a way Japan’s Haneda Airport screening procedures failed to detect a large knife that a 28-year-old man carried aboard ... alienation, and disorientation through an absolute dedication to an Islamic way of life Accordingly, the Islamic fundamentalist is commonly depicted as an acutely alienated individual, with dogmatic and...
Ngày tải lên: 07/11/2012, 14:21
Tài liệu PSYCHOSYNTHESIS: A Psychology of the Spirit pdf
... Catherine of Sienna, and St Dominic; Socrates, Plato, and Aristotle; Dante, Emerson, and Thoreau; Nietzsche, Teilhard de Chardin, and Evelyn Underhill; Patanjali, Radhakrishnan, and Vivekananda; ... represented at all and should be imagined as pervading all of the areas of the diagram and beyond The need for this change will be discussed at the end of the chapter One general comment about the diagram ... toward increasing wholeness, both within the individual and in the individual’s relationship to the world at large Assagioli agreed with Freud that healing childhood trauma and developing a healthy...
Ngày tải lên: 15/02/2014, 15:20
Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc
... interest-earning assets); LOTH = “other” liabilities (as a share of total liabilities); SD = savings deposits (as a share of total liabilities); DTD = demand and transaction deposits (as a share of ... effects—which 24 A number of authors have attributed the failure of the standard CAPM to its static nature; see, for example, Hansen and Richard [1987], Jagannathan and Wang [1996], and Gomes et al [2003] ... low-yielding savings and transaction deposits We find that this so-called deposit disintermediation is especially pronounced for large banks and institutions that rely heavily on demand and transaction...
Ngày tải lên: 17/02/2014, 03:20
THE SOCIOLOGY AND PSYCHOLOGY OF TERRORISM: WHO BECOMES A TERRORIST AND WHY? ppt
... case.” Mentally unbalanced individuals have been especially attracted to airplane hijacking David G Hubbard (1971) conducted a psychiatric study of airplane hijackers in 1971 and concluded that ... measures Even then, an individual wanting to hijack an airplane can often find a way Japan’s Haneda Airport screening procedures failed to detect a large knife that a 28-year-old man carried aboard ... alienation, and disorientation through an absolute dedication to an Islamic way of life Accordingly, the Islamic fundamentalist is commonly depicted as an acutely alienated individual, with dogmatic and...
Ngày tải lên: 06/03/2014, 05:20
Glimpses of the Past History of the River St. John, A.D. 1604-1784 ppt
... chieftain Madockawando and was highly esteemed by the savages It was at the instigation of St Castin and Madockawando that the Indians determined to take the war path The first notable incident of ... caribou and red deer roamed in savage freedom Wild fowl of all kinds abounded along the marsh, and interval lands of the St John, and the river itself undisturbed by steamboats and unpolluted ... command by land and sea, appoint officers of government and justice, keep such lands as he fancied and grant the remainder to his vassals He had also a monopoly of the fur trade and with Fort la...
Ngày tải lên: 08/03/2014, 13:20
Buying Trances: A New Psychology of Sales and Marketing
... bike riding, video production, and health Had I talked about any of those subjects, he would have leaned forward and asked a lot of questions He wasn’t in a Buying Trance His wife was Your readers, ... such as eBay sell for $300 a copy He also had old magazines, signed books and letters from famed hypnotists, and much more We had a friendly conversation about hypnosis and magic that lasted only ... trance state stayed deep because Stage Hypnotist Simone stroked my ego and again stayed focused on me and my desires He also mentioned such facts as some of the material being out of print and...
Ngày tải lên: 07/04/2014, 11:17
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
... testicular hyaluronidase (Sigma) After an incubation of 30 at 37°C and 5% CO2, the media was replaced and the incubation was continued at 37°C for an additional h Chondrocytes were centrifuged and ... grid of dots marked on surface Photograph and line drawing of the Gelfoam sponge loaded in a square petri dish with a by grid of dots marked on surface The stationary clamp edge is on left, and ... probed with antibodies The primary antibodies used were a polyclonal antibody against Col X [10], and a monoclonal antibody against β-actin Horseradish peroxidase conjugated goat anti-mouse or goat...
Ngày tải lên: 20/06/2014, 00:20
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf
... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... TGTTGACAGYCVTT CCKGGT TAYTTTAAAARGTGTCMAGTGT CTYTTAAAAGGKGTCCAGWG CYTTTAMATGGTATCCAGTGT ATGGCAGCWGCYCAAAG CTTTTAAAAGWTGTCCAGKGT CTTCCTGATGGCAGTGGTT TAACCCTTGACCAGGCATCC Key to degenerate nucleotides: ... TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG AGGTVVAGCTGCAGVAGTCWGG ACTGCAGGTRTCCACTCC RCTACAGGTGTCCACTCC GCYACAGMTGTCCACTCC ACTGCAGGTGTCCTCTCT RCTRCAGGYGTCCACTCT CCAAGCTGTGTCCTRTCC...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf
... operationalised key terms like subjective and psychological well-being, meaning, flow and strengths and have developed a range of corresponding measures Based on the outstanding work of authors such as Alan ... today than it was several decades ago and collaborations with scholars from diverse backgrounds are more plausible as interest in well-being becomes more widespread Moreover, the public demand ... calibre of scholars currently dedicated to well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated...
Ngày tải lên: 21/06/2014, 06:20
THE FIRST EIGENVALUE OF p-LAPLACIAN SYSTEMS WITH NONLINEAR BOUNDARY CONDITIONS D. A. KANDILAKIS, M. pptx
... the case of the Laplacian operator in a bounded domain It is well known that these properties also hold for the p-Laplacian scalar eigenvalue problem (in both bounded and unbounded domains) and ... Aegean under the Project EPEAEK II-PYTHAGORAS with title “Theoretical and Numerical Study of Evolutionary and Stationary PDEs Arising as Mathematical Models in Physics and Industry.” The third author ... author acknowledges support by the Operational Program for Educational and Vocational Training II (EPEAEK II) and particularly by the PYTHAGORAS Program no 68/831 of the Ministry of Education of...
Ngày tải lên: 23/06/2014, 00:20
Wingonomics – The Psychology of Money Mark A. Wingo pptx
... your financial goals Mortgage Planner, CPA, Real Estate Agent, Financial Planner, and Personal Banker are all great examples of a financial empowerment team e Remember, T.E .A. M means, Together ... need different way to bridge the financial gap(s) we are facing Life insurance can be that option and provide the cash needed to secure your family’s future b We all need additional ways to fund ... into a situation of not being able to pay your bills, simple contact your creditor and explain why d Understand good debt vs bad debt A good debt is something that allows you to create wealth...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo toán học: "Two remarks concerning the theorem of S. Axler, S.-Y. A. Chang and D. Sarason " docx
Ngày tải lên: 05/08/2014, 15:20
báo cáo khoa học: "Failure of functional imaging with gallium-68DOTA-D-Phe1-Tyr3-octreotide positron emission tomography to localize the site of ectopic adrenocorticotropic hormone secretion: a case report" ppsx
... alopecia, lethargy, amenorrhea and marked anxiety An examination revealed features of Cushing’s syndrome with rounded face, buffalo hump, abdominal striae and proximal muscle weakness Investigations ... Victoria, Australia Authors’ contributions EG, AC and RM analyzed and interpreted the patient’s data and were involved in the patient’s care LG was a major contributor to writing the manuscript All ... the Austin Hospital’s thoracic surgical unit and its radiology department for their assistance in the management of this patient Author details Endocrine Centre and Department of Medicine, Austin...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: " Dietary intake of fish, omega-3, omega-6 polyunsaturated fatty acids and vitamin D and the prevalence of psychotic-like symptoms in a cohort of 33 000 women from the general population" ppt
... eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA) and docosapentaenoic acid d Sum of eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), docosapentaenoic acid and α-linolenic acid e Sum of arachidonic ... docosahexaenoic acid (DHA) and docosapentaenoic acid d Adjusted for age, total energy intake and dietary intake of vitamin B12, alcohol and dietary intake of fat other than eicosapentaenoic acid, ... acid, docosahexaenoic acid and docosapentaenoic acid e Sum of arachidonic and linoleic acids f Adjusted for age, total energy intake and dietary intake of vitamin B12, alcohol and dietary intake of...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "Coccidioides posadasii infection alters the expression of pulmonary surfactant proteins (SP)-A and SP-D" pps
... anti-human-SP -A and anti-mouse SP -D antibodies recognized 34 kDa and 43 kDa monomer bands of SP -A and SP -D in BALF and lung tissue samples (Fig 1) The upper bands of approximately 68 kDa and 85 kDa ... for SP -A and SP -D The concentrations of SP -A and SP -D were measured in BALF samples as described earlier [20] The antibodies against SP -A and SP -D reacted with 34 kDa (SP -A) and 43 kDa (SP -D) immunroreactive ... Contributions SA designed and co-ordinated the study, performed assays and statistical analysis and drafted the manuscript JJC assessed lung pathology DMM prepared and immunized mice with FKS All authors...
Ngày tải lên: 12/08/2014, 18:21