s rt melt a novel technology for mutation screening
Báo cáo y học: "A Melanesian -thalassemia mutation suggests a novel mechanism for regulating gene expression" potx
Ngày tải lên :
14/08/2014, 17:22
... ␣-globin and -globin chains that make up hemoglobin is unbalanced This Melanesian form of HbH disease is the first natural example of a mutation that causes the function of an enhancer to be ‘trapped’ ... has the most powerful enhancer activity [4] De Gobbi et al [2] have now characterized the mutation responsible for Melanesian HbH disease as a gain-offunction allele of SNP 195 that creates a ... phenotype The A G transition created a known binding site (TAATAA→TGATAA) for the erythroid-specific transacting factor GATA1 This altered binding site also nucleates the binding of a pentameric erythroid...
- 3
- 137
- 0
Tài liệu De-interlacing A Key Technology for Scan Rate Conversion doc
Ngày tải lên :
10/12/2013, 14:15
... a visual-communication system also involves display and transmission of video signals The issue translates for the transmission channel into the question: 'Is interlacing and de-interlacing still ... of America, but also in some countries in Asia, like Japan In most other parts of the world, a standard of 50 pictures per second (using 625 scanning lines) was adopted A video transmission system ... book, is the reverse operation aiming at the removal of the sub-sampling artefacts The major flaw of interlace is that it complicates many image processing tasks Particularly, it complicates scanning-format...
- 369
- 428
- 0
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx
Ngày tải lên :
23/01/2014, 07:20
... economical than immersive systems Desktop systems let users view and interact with entities in a 3D environment using a stereo display monitor and stereo glasses Such systems are adequate for tasks ... EyeGlasses system.7 Audio After sight, sound is the most important sensory channel for virtual experiences It has the advantage of being a channel of communication that can be processed in parallel ... one approach that has developed is to use a VR-based design and visualization system The VR-based CAD system (as discussed in Section 14.6.2) allows changes to the "virtual prototype" to be made...
- 10
- 634
- 1
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
Ngày tải lên :
07/03/2014, 03:20
... which was correctly recognized by the National Institute of Standards and Technology (NIST) library (mass spectral search program Version 2.0) In addition, these GC-MS analyses (data not shown) ... formation A Ilg et al to the peak area of the internal standard, which was quantified at its absorption maximum of 285 nm Enzyme assays Synthetic substrates were kindly provided by BASF (Ludwigshafen, ... and carotenoids were extracted and processed as described above Analytical methods For HPLC analyses, a Waters system equipped with a photodiode array detector (model 996) was used A C30-reversed...
- 12
- 497
- 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt
Ngày tải lên :
07/03/2014, 21:20
... product as a class IIIc AC which has a glutamineasparagine pair at the positions defining ATP as a substrate instead of the lysine-aspartate consensus We show that the purified catalytic domain of ... stabilizing asparagine does not contact the substrate and mutagenesis shows that it appears not to be involved in catalysis Furthermore the asparagine-aspartate couple which replaces the usual substrate-specifying ... In all structures of canonical ACs, i.e mammalian AC, trypanosomal AC and mycobacterial AC Rv1264 the lysine-aspartate couple forms a salt bridge [5,7,26] Even in Rv1900c the asparagine-aspartate...
- 8
- 401
- 0
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
Ngày tải lên :
22/03/2014, 17:20
... We thank our patients who participated in our treatment program, Jill Hansen for her expert technical assistance, Laura Longoria for secretarial assistance, Dr Satadal Das for helpful discussion, ... Diagnoses were based on radiology and/or histopathology Most of these cases were at the advanced stage of the disease when homeopathic treatment was started in Kolkata, India The patients gradually improved, ... Chandra J, McConkey DJ, Newman RA and Pathak S: Caspase-dependent apoptosis induced by telomere cleavage and TRF2 loss Neoplasia 2: 339-345, 2000 12 Pathak S, Multani AS, McConkey DJ, Imam AS and...
- 8
- 670
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
Ngày tải lên :
23/03/2014, 13:20
... GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC Nested pair ATGTGGCTGCATGGGACGTG TCTGCAGGGTCACGGAGATG Exon Exon ... photodiode array detector (SPD-M10Avp) and quadrupole mass spectrometer The LC/MS workstation CLASS-8000 software was used for system control and data acquisition (Shimadzu) Elution was carried out isocratically ... LC/MS and GC/MS, we demonstrate that mammalian P450scc transforms 7-DHC to 7-DHP with high efficiency As 7-DHC is readily available in human skin, it represents a natural substrate for P450scc,...
- 11
- 475
- 0
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
Ngày tải lên :
30/03/2014, 15:20
... antibody Possible roles of p53 SCS DNA binding in the regulation of its biological activities are discussed Materials and methods DNA samples Supercoiled (sc) DNA of plasmid pBSK(–) (not containing ... circular (rel) DNA was prepared using wheat germ topoisomerase I (Promega) To generate open circular (oc) DNA, the scDNA sample was irradiated with c-rays from a Chisostat 60Co source (Chirana, ... the samples at the same time as the scDNA After binding, the samples were loaded on or 1.3% agarose gel containing 0.33· Tris/Borate/EDTA buffer, pH 8.0 Agarose gel electrophoresis was performed...
- 12
- 265
- 0
a novel method for the synthesis of titania nanotubes using
Ngày tải lên :
05/05/2014, 15:26
... et al [22] and Schmuki et al [23] The materials were annealed in various temperatures and gaseous atmospheres to transfer the amorphous TiO2 nanotubes to crystalline materials A representative ... spectra of TiO2 samples were measured from the optical absorption spectra using a UV–vis spectrophotometer (UV-2401 PC, Shimadzu) Fine BaSO4 powder was used as a standard for baseline and the spectra ... photocurrent generated A 300-W solar simulator (69911, Newport-Oriel Instruments, USA) was used as a light source The samples were anodically polarized at a scan rate of mV /s under illumination, and the...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
Ngày tải lên :
06/05/2014, 08:55
... chromatography coupled with mass the mass spectra for 2-CEPS, HEPS and PVS spectrometry (GC-MS) analysis was used are shown These compounds have a lower The detector was set to scan a mass range ... nanoparticles and sulfurous compound, all samples were by studying the images indicates that the attached to a shaker and were shaken for about synthesized size nanoparticles are less than 12 h Then, ... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials,...
- 12
- 705
- 0
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
Ngày tải lên :
18/06/2014, 16:20
... Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... cohort showed a greater change from baseline than did the control cohort Results Exhaustive Expansion In both studies, standard FCM analysis software was used to establish positive and negative ... derived data values are simply the sum of the frequencies of the relevant subsets The output was then loaded into a relational database (MySQL), and standard SQL statements and graphing utilities were...
- 15
- 476
- 0
Báo cáo sinh học: " Body fluid derived exosomes as a novel template for clinical diagnostics" pptx
Ngày tải lên :
18/06/2014, 19:20
... secondary antibody and ECL detection FACS analysis FACS analysis of isolated vesicles was done after adsorbing isolated vesicles to μm (Surfactant-free) aldehydesulfate latex beads (Interfacial ... Ekstrom K, Eldh M, Torregrosa Paredes P, Bossios A, Sjostrand M, Gabrielsson S, Lotvall J, Valadi H: Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages J Transl ... compare and quantify different measurements a cellular cDNA was used as standard and the amount was calculated after amplification Chemicals and antibodies RNA / DNA purification and cDNA synthesis...
- 9
- 368
- 0
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
Ngày tải lên :
19/06/2014, 08:20
... characteristics Self-rated pain was assessed as pain at the moment and measured within a week before the day of testing on a blank 100 mm visual analogue scale (VAS), on which mm corresponds ... "no pain at all" and 100 mm to "worst imaginable pain" [27] Self-reported characteristics were assessed by the following questionnaires: The Short Form 36 (SF-36) was used as a measure of subjective ... represent different aspects of sensorimotor control as indicated by weak or absent intervariable correlations [20,21] In the postural sway test the subject was instructed to stand as still as possible...
- 10
- 712
- 0
Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx
Ngày tải lên :
20/06/2014, 00:20
... reasons The first reason is the imminent concomitance of distress and sickness absence Distress as a main cause of sickness absence can be labeled under 'adjustment disorders' following the DSM ... anxiety Under less favorable conditions, distress might be a precursor for more serious psychiatric disorders On the other hand, psychiatric illness can act as a stressor that aggravates strain ... primary health care According to Terluin, distress is the psychological squeal of strain caused by unsuccessfully coping with a stressor Stressors can be the common cause for distress and depression...
- 8
- 396
- 0
báo cáo hóa học:" Body fluid derived exosomes as a novel template for clinical diagnostics" ppt
Ngày tải lên :
20/06/2014, 03:20
... secondary antibody and ECL detection FACS analysis FACS analysis of isolated vesicles was done after adsorbing isolated vesicles to μm (Surfactant-free) aldehydesulfate latex beads (Interfacial ... Ekstrom K, Eldh M, Torregrosa Paredes P, Bossios A, Sjostrand M, Gabrielsson S, Lotvall J, Valadi H: Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages J Transl ... compare and quantify different measurements a cellular cDNA was used as standard and the amount was calculated after amplification Chemicals and antibodies RNA / DNA purification and cDNA synthesis...
- 9
- 505
- 0
Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt
Ngày tải lên :
20/06/2014, 21:20
... decreases, and series resistance [Rs] increases Increased leakage current and decreased Rsh cause a decrease in the short-circuit current density [Jsc] Increased Rs and decreased Rsh result in a sharp ... oxidation process is also thin and does not serve as a good passivation or ARC layer It shows that the best passivation is obtained when the thickness of the Mg metal is around 200 Å As the amount of ... contact resistance To calculate the contact resistance, Mg was evaporated on the n-Si wafer, and the Ag paste was printed on the Si wafer for reference The contact resistances of Mg/Si and Ag/Si...
- 14
- 648
- 0
Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf
Ngày tải lên :
20/06/2014, 22:20
... results in Section 4, the RMSE values of TSaT-MUSIC and TST-MUSIC became worse This deterioration was presumably caused by the same reasons as discussed in the 3D localization experiment As for ... algorithm The TSaT-MUSIC algorithm allows us to simultaneously obtain the DOA and delay values in a 2D space By using an L-shaped ultrasonic sensor array as shown in Figure 4, TSaT-MUSIC can be extended ... The same signals were transmitted from transmitters, and the spatial smoothing method was applied in the same way as in the 2D localization simulations The SNR was set to 20 dB Because the L-shaped...
- 8
- 432
- 0
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
Ngày tải lên :
21/06/2014, 11:20
... comprises four different network models In all cases, the new strategy provides the best tradeoff between fairness and AME Fairness 2.1 Formulas for OMA and SIC It is well known for OMA method that ... OMA The beneficial effects of the newly proposed strategy can be observed for BORG∗ , which performs as well as OMA for K small Δ(I) , but surpasses both OMA and SIC for large Δ(I) More interestingly, ... we show the Average AME for the six methods which are compared As it was already pointed out previously, OMA achieves always the maximum possible AME We can notice from Figure 2(b) that SIC and...
- 10
- 385
- 0
Báo cáo hóa học: "Research Article A Novel Criterion for Writer Enrolment Based on a Time-Normalized Signature Sample Entropy Measure" pptx
Ngày tải lên :
21/06/2014, 19:20
... databases, as shown in Figure for some signatures in DS2, whose owners authorized their publication Figure shows that the obtained three categories are actually linearly separable, as represented ... the raw coordinates description of signatures as input data: a Hidden Markov Model [3] and a Gaussian Mixture Model [14] For performance assessment, both skilled and random forgeries are considered ... random samplings are carried out on genuine and impostor signatures in the following way: each sampling contains five genuine signatures used as the training set for both statistical classifiers...
- 12
- 409
- 0
Báo cáo hóa học: " A Novel Route for Preparation of Hollow Carbon Nanospheres Without Introducing Template" ppt
Ngày tải lên :
22/06/2014, 00:20
... carbon nanospheres and their loading structure have potential application in many fields such as carriers, storage, and catalysts Acknowledgments The authors acknowledge the National Natural Science ... content was also observed Then a possible forming mechanism was given Hollow carbon nanospheres loading SnO2 nanoparticles were synthesized and its photoluminescence peak appeared at 376, 424, and ... These varieties of products revealed that the content is a crucial factor for preparing carbon nanospheres in a large scale Because the carbonization process was actually a defunctionalization...
- 6
- 349
- 0