rotating flipping a part during placement

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Ngày tải lên : 19/02/2014, 02:20
... GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG ... forward forward forward reverse reverse forward reverse forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC ... each acclimation temperature was quantified (Table 3) At AT ¼ 18 °C the ratio between b mRNAa ldh a and mRNAldh a is almost : However, at AT ¼ °C the specific total mRNAldh a content decreases and...
  • 11
  • 662
  • 0
Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

Ngày tải lên : 23/03/2014, 19:20
... Table 2: Character type configuration of infrequent words in the E D R corpus character type sequence kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana ... play an important role in tagging part of words and Japanese words semantically equivalent speech Table shows examples of common charto Chinese characters Hiragana and katakana are acter bigrams ... akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent 45.1% 11.4% 6.5% 5.6% 3.7% 3.4% 3.0% 2.6% 2.4% 2.0% 1.7% 1.3% examples =~y~T'I/y Y t *ag,...
  • 8
  • 397
  • 0
NUPOS: A part of speech tag set for written English from Chaucer to the present ppt

NUPOS: A part of speech tag set for written English from Chaucer to the present ppt

Ngày tải lên : 24/03/2014, 19:20
... Christianly 0.5 unchristianly 0.2 av-dx av-j av-j-u av-jc av-jp-u av-js av-n av-s av-u av-vvg av-vvg-u av-vvn past participle as adverb ccx crd cs cst d dc past participle as adverb (un) negative adverb ... present participle as adjective (un-) past participle as adjective past participle as adjective (un-) comparative adjective comparative adj/noun comparative adjective (un-) present participles as ... NUPOS, page 17 av-jn negative determiner as adverb adjective as adverb adjective as adverb (un) comparative adjective as adverb adj/noun as adverb av-jn-u un-adj/noun as adverb (un-) unduly 0.3 av-jp...
  • 25
  • 516
  • 0
You recently took a part

You recently took a part

Ngày tải lên : 14/07/2014, 11:05
... important to you - tell the family about your arrival date and time This task was taken from the book IELTS on Track: Test Practice General Training Dear Mr Jones, I have just received details ... my dissatisfaction with the service I received at your establishment Actually, the computer I have bought at your store on the late January was quite good, however after just half a year things ... homestay at your family and writing to introduce myself and ask for some further information My name is Anna Frank, I am 21 and live with my family in Lyon, France, which is my hometown My native...
  • 5
  • 207
  • 0
Báo cáo khoa học: "Circadian variations in salivary chromogranin a concentrations during a 24-hour period in dogs" pps

Báo cáo khoa học: "Circadian variations in salivary chromogranin a concentrations during a 24-hour period in dogs" pps

Ngày tải lên : 07/08/2014, 23:22
... 237-244 Sato F, Kanno T, Nagasawa S, Yanaihara N, Ishida N, Hasegawa T, Iwanaga T Immunohistochemical localization of chromogranin A in the acinar cells of equine salivary glands contrasts with ... 422 Kazutaka Kanai et al were measured using a Human CgA enzyme-linked immunosorbent assay kit (Yanaihara Institute, Japan) All samples were analyzed in duplicate Salivary CgA concentrations ... 355-357 Nakane H, Asami O, Yamada Y, Harada T, Matsui N, Kanno T, Yanaihara N Salivary chromogranin A as an index of psychosomatic stress response Biomed Res 1998, 19, 401-406 Saruta J, Tsukinoki...
  • 3
  • 317
  • 0
Báo cáo y học: "Sudden deterioration due to intra-tumoral hemorrhage of ependymoma of the fourth ventricle in a child during a flight: a case report" pps

Báo cáo y học: "Sudden deterioration due to intra-tumoral hemorrhage of ependymoma of the fourth ventricle in a child during a flight: a case report" pps

Ngày tải lên : 11/08/2014, 12:20
... revealed an anaplastic ependymoma Our patient was seen by our pediatric oncologist for adjuvant chemotherapy Six months later, he underwent standard cranial Figure Brain magnetic resonance imaging ... Pediatrics 1992, 90:385-391 10 Federal Aviation Administration: Allowable carbon dioxide concentration in transport category airplane cabins [http:// www.airweb.faa.gov/Regulatory_and_Guidance_Library/rgNPRM.nsf/ ... tumor was soft, reddish-gray, amenable to suction and highly vascular containing a large area of hemorrhage (Figures and 3) It was almost completely resected except for a thin layer attached to...
  • 4
  • 352
  • 0
Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot

Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot

Ngày tải lên : 12/08/2014, 04:21
... influenza A subtype analysis Its ease of operation makes it suitable for laboratories with a limited budget or limited molecular knowledge 10 11 Bright RA, Shay DK, Shu B, Cox NJ, Klimov AI: Adamantane ... nucleic acid was extracted from each specimen using the easyMag automated extraction system (bioMérieux, Montreal, Canada) as per the manufacturer's protocols To control for extraction all specimens ... prevalent in clinical microbiology laboratories, and is essential for public health surveillance of circulating strains, determination of annual vaccine mismatch and therapeutic decision making...
  • 3
  • 246
  • 0
Báo cáo khoa học: "What does high NT-proBNP mean in septic shock patients? A part of the puzzle" pdf

Báo cáo khoa học: "What does high NT-proBNP mean in septic shock patients? A part of the puzzle" pdf

Ngày tải lên : 13/08/2014, 03:20
... plasma level as an early marker of prognosis and cardiac dysfunction in septic shock patients Crit Care Med 2005, 33:1001-1007 Tomaru Ki K, Arai M, Yokoyama T, Aihara Y, Sekiguchi Ki K, Tanaka ... K, Tanaka T, Nagai R, Kurabayashi M: Transcriptional activation of the BNP gene by lipopolysaccharide is mediated through GATA elements in neonatal rat cardiac myocytes J Mol Cell Cardiol 2002, ... 2002, 34:649-659 Ma KK, Ogawa T, de Bold AJ: Selective upregulation of cardiac brain natriuretic peptide at the transcriptional and translational levels by pro-inflammatory cytokines and by conditioned...
  • 2
  • 339
  • 0
Báo cáo y học: "MNF, an ankyrin repeat protein of myxoma virus, is part of a native cellular SCF complex during viral infection" pot

Báo cáo y học: "MNF, an ankyrin repeat protein of myxoma virus, is part of a native cellular SCF complex during viral infection" pot

Ngày tải lên : 12/08/2014, 04:20
... Research and Technology We thank Brigitte Peralta and Josyane Loupias for excellent technical assistance We are grateful to B Séverac for critical reading of the manuscript Author details INRA, ... SBl carried out all the experiments and drafted the manuscript CC, SBe and JG participated in the design of the study and revision of the manuscript All authors read and approved the final manuscript ... mediates host-range function in RK-13 cells via ANK repeat Moreover, K1L may interact with a cellular GTPase-activating protein [19] and inhibits host NFB activation by preventing IBa Blanié...
  • 5
  • 268
  • 0
A to Z Intermediate part 1

A to Z Intermediate part 1

Ngày tải lên : 03/10/2012, 15:01
... Barbara Bargagna, Monica Ciampi, Paolo Bassi, Andrea Ceccolini, Carlo Bellanca, Claudia Rege Cambrin, Luca Zamboni, Sergio Marchetti, Guido Coli (and all at LIST), Gianluca Soria, Patrizia Caselli ... Caselli (and all at SIAS) Thanks also to LIST SpA for technological support, to International House in Pisa, in particular Chris Powell, Paola Carranza, Lynne Graziani and Antonia Clare, and to Tau ... meant that a man could amass Should parents be allowed to decide who their children marry? What are the advantages of an arranged marriage? What are the dangers of a marriage that is only based...
  • 115
  • 765
  • 5