role of ethics in handling a crisis situation

Ngày tải lên: 12/08/2014, 16:20

... technical advance take place, primarily are those where a firm, or a national economy, is engaged in routine activities. Thus, each national system of innovation is rooted in a na- tional system of ... On average the academic staff makes up about half of total staff. Funding of terti- ary education from the Ministry of Education and Research amounted to 16 billion NOK in 2002. External financing ... institutioner om ingår i det regionala in- novationssystemet rimliga förutsättningar för sin verksamhet samt att skapa ett system av incitament som belönar vissa typer av handlingar. 21 sities have a strong...

Ngày tải lên: 16/01/2014, 16:33

... & Vaux DL (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43–53. 7 Suzuki Y, Imai Y, Nakayama H, Takahashi ... [19]. In mammalian apop- tosis, caspase-8 and caspase-9 are known to be associ- ated with the mitochondrial pathway. Active caspase-8 induces the release of mitochondrial apoptosis factors, in a ... (A) Fractionation PCR. A partial fragment of the mitochond- rial large subunit ribosomal RNA (23S rRNA) was amplified by PCR, using fraction samples that contained equal amounts of protein. Lane,...

Ngày tải lên: 20/02/2014, 03:20

... Migraine without aura Cluster headache Paroxysmal unilateral headache Neurovascular variants Arteritis pain Carotidynia joint surface pain Retrodiscal palm Capsule pain Ligament ... Glandular, ocular, and auricular pain Pulpaf pain Visceral mucosal pain Periodontal pain Connective- tissue pain Ostealgia m6 periosteal pain jyjpaln — Neuropathic pain Physical ... through inflammation or rupture, resultina in Dain. 8 Primary Dental Evaluation Findings in the Teeth and Mucous Membrane The intraoral evaluation includes in particular: ã careful evaluation...

Ngày tải lên: 06/03/2014, 11:20

... pictures are present during both learning and recall. A clinical example would be a health professional telling a patient or family caregiver how to treat a bed sore while viewing matching pictures and ... there are large numbers of people with low literacy skills as shown in Table 2 [8]. Gazmararian et al. [9] reported, in a study of 3260 enrollees in a national managed care organization in the United ... Fehrenbach SN, Ren J, Koplan JP. Health literacy among medicare enrollees in a managed care organization. JAMA 1999; 281:545–51. [10] International Reading Association, Special Interest group on reading and...

Ngày tải lên: 14/03/2014, 21:20

... still falling. Children Living in Urban Settings The process of urbanization in India is at a critical point of transition. India has a young and rapidly growing population, a potential demographic ... note that several challenges related to infrastructure, capacities, mass information and awareness, teacher availability, training functional redressal mechanisms, and effective monitoring system will ... education, starting at age six years may be too late to lay Table 5: Learning achievements (in per cent) among students of Class V in India - 2002-2003 and 2006-2007 Year of survey Mathematics Language...

Ngày tải lên: 30/03/2014, 03:20

... number Enzyme ADA Adenosine deaminase 3.5.4.4 ADPRT Adenine phosphoribosyltransferase 2.4.2.7 AK Adenosine kinase 2.7.1.20 ALD1 Fructose-diphosphate aldolase 4.1.2.13 AMPDA Adenosine monophosphate deaminase 3.5.4.6 APK ... 5Â-monophosphate INO Inosine K + Potassium LAC L-Lactate MetAcc Methylated acceptor Na + Sodium NAD Nicotinamide adenine dinucleotide NADH Nicotinamide adenine dinucleotide reduced NADP Nicotinamide adenine ... absence of adenosine kinase, as long as adenine phosphoribosyl transferase (ADPR transferase, or ADPRT) is present. This is indicative of an alternative salvage pathway in human erythrocytes, and...

Ngày tải lên: 30/03/2014, 20:20

... mortality rates of ovarian cancer, with the highest rates observed in Northern and Western Europe, notably Scandinavia, and in North America [4]. Ovarian cancer is often asymptomatic in its early stages and ... laparotomy redundant. Cancer 1996, 77:1122-1130. 72. Mano A, Falcao A, Godinho I, Santos J, Leitao F, de Oliveira C, Cara- mona M: CA-125 AUC as a predictor for epithelial ovarian cancer relapse. ... JM, Clarke-Pearson D, Burger RA, Mannel RS, DeGeest K, Hartenbach EM, Baergen R: Phase III trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally...

Ngày tải lên: 20/06/2014, 07:20

... study was to develop a culturally appropriate approach for obtaining assent from children aged eight to 17 years to participate in paediatric HIV-related operational research in Kinshasa, Democratic Republic ... University of North Carolina at Chapel Hill, USA, 3 School of Public Health, University of Kinshasa, Kinshasa, Democratic Republic of Congo, 4 Department of Dental Ecology, University of North Carolina ... been informed of their HIV status. Additionally, at that time, very little was known in the sub-Saharan African context about what role, if any, chil- dren play in decision making on research participation, and...

Ngày tải lên: 20/06/2014, 08:20

... Hemoglobin 2005, 29:91-106. 15. Giardine B, van Baal S, Kaimakis P, Riemer C, Miller W, Samara M, Kollia P, Anagnou NP, Chui DH, Wajcman H, Hardison RC, Patrinos GP. HbVar database of human hemoglobin ... longer easily available in routine and even reference laboratories. Lichtman and colleagues have reported a mathematical formula which can be used to calculate P50 reliably [5]. Calculating P50 ... [15]. All these Hb variants are inherited in an autosomal dominant manner. High affinity Hb variants release oxygen in the tissue relatively slowly and create relative tissue hypoxia. This leads...

Ngày tải lên: 08/08/2014, 16:23

... in (disease sub-type-specific) meta-analyses. ITGAV is the latest example of a candidate gene that may be relevant to RA. Increased significance in the combined samples in the study of Jacq and ... Migliorini P, Balsa A, Westhovens R, Barrera P, Alves H, et al.: The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study. Arthritis ... OR in the range 1.1 to 1.2, variants of PADI4 and CTLA4 confer a similar risk to that of the new ITGAV variant. Because confirmed associations account for only about 50% of RA genetics, more candidate...

Ngày tải lên: 09/08/2014, 10:21

... pQE-ygfZG22 7A PygfZG227AR GTCCGGTATAACAGGCTTTCTTAAAG PygfZC228AF CTTTAAGAAAGGGGCTTATACCGGACAAG pQE-ygfZC22 8A PygfZC228AR CTTGTCCGGTATAAGCCCCTTTCTTAAAG PygfZC228SF CTTTAAGAAAGGCTCGTATACCGGAC pQE-ygfZC228S PygfZC228SR ... GTCCGGTATACGAGCCTTTCTTAAAG PygfZC228MF CTTTAAGAAAGGCATGTATACCGGAC pQE-ygfZC228M PygfZC228MR GTCCGGTATACATGCCTTTCTTAAAG PygfZY229AF TAAGAAAGGCTGTGCTACCGGACAAG pQE-ygfZY22 9A PygfZY229AR CTTGTCCGGTAGCACAGCCTTTCTTA PygfZT230AF ... CCATGGCCGCAGTCCCTGCCCCAGACCC pQE-Rv_0811c PRv0811cR AGATCTCCGAATACCGCCGCGCAGCCGC PygfZK226AF CAGCTTTAAGGCCGGCTGTTATACCG pQE-ygfZK22 6A PygfZk226AR CGGTATAACAGCCGGCCTTAAAGCTG PygfZG227AF CTTTAAGAAAGCCTGTTATACCGGAC...

Ngày tải lên: 10/08/2014, 05:21

... of data, and anal- ysis of data. AP, SM, CG, OLS, VV and ER have been involved in drafting the manuscript or revising it, and for critical review of important intellectual content. SP gave final ... [3]. Cardiovascular collapse due to ana- phylaxis is a vasodilatory shock, characterized by an abrupt fall in systemic vascular resistance, enhanced vas- cular permeability, intravascular volume ... (NO) and the prostacycline mediated vasodilating pathways [5]. Activation of induci- ble NO synthase (iNOS) is a major contributor to both vasodilatation and resistance to the catecholamine vaso- pressor...

Ngày tải lên: 11/08/2014, 11:20

... -AGGATGGACAAACCCGTGAG-3’ and 5’-AAGC- CAGAGATGGGGACAAA-3’, and the amplicons have a predicted size of 232 bp and 202 bp, respectively. For each gene, a calibration curve was constructed by mea- suring ... 8(1):428. 28. Davies C, Robinson SP: Differential screening indicates a dramatic change in mRNA profiles during grape berry ripening. Cloning and characterization of cDNAs encoding putative cell wall and ... 2004, 55(1):45-59. 65. Cho S, Jang S, Chae S, Chung KM, Moon YH, An G, Jang SK: Analysis of the C-terminal region of Arabidopsis thaliana APETALA1 as a transcription activation domain. Plant Mol Biol 1999,...

Ngày tải lên: 11/08/2014, 11:21

Ngày tải lên: 11/08/2014, 14:21

Ngày tải lên: 12/08/2014, 16:20

Ngày tải lên: 12/08/2014, 23:20

Ngày tải lên: 12/08/2014, 23:21

Ngày tải lên: 12/08/2014, 23:23