roc analysis as a performance measure

... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of  them are introduced as follows.  ... Table 7. Standardized score for costs of combinations  Measure A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... local  farmers  and  authorities  have  been  facing  some problems such as water pollution, salinity  intrusion and the spread of shrimp’s diseases.  In order to have feasible sets of measures ...

Ngày tải lên: 22/03/2014, 12:20

... heritage and art forms, local festivals, road drives and activities for children As (1) asserted that it is important to measure consumer satisfaction applying as many destination attributes as ... s c o m [39] Bindu Narayanan, Chandrasekharan Rajendran, Prakash Saia, L, Ram Gopalan,“Dimensions of service quality in tourism – an Indian perspective”, Total Quality Management, Vol 20, No ... the mean importance and performance of destination attributes VIII Analysis and Discussion Table 1: Importance Performance Means Destination attributes Mean Beach Backwaters Ayurveda Mountains/hill...

Ngày tải lên: 01/08/2014, 10:25

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

Ngày tải lên: 19/02/2014, 17:20

... (Table 3) as well as clinical data (Table 4) in studied tissues and blood was observed Discussion The critical role of circulating tumor cells in metastatic spread of carcinomas has already been ... (Figure 2B and 4B) was found This activity was 10 higher than in other cases which may indicate patients in metastasis stage Analysis of results demonstrated that in part of the studied blood samples ... this article as: Andrusiewicz et al.: CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances Journal of Translational...

Ngày tải lên: 18/06/2014, 22:20

... like mercapturic acid, glucoronic acid as well as acetyl-/diacetyl isocyanate diamines to corresponding MDA, HDA, TDA, NDA and IPDA For the current analysis, all patient samples, standards and controls ... methods, validation and controls and materials) Data analysis The excretion of the isocyanate diamines was expressed as median values ± SD (standard deviation) of the respective amine, per g creatinine ... manufacturer Additionally, a part of the isocyanate air samples was measured with the HPLC filter extraction method The relative humidity was 35-50% and the temperature 20-25°C as measured by thermohydrometer...

Ngày tải lên: 20/06/2014, 00:20

... content) Shrinkage was measured using a special device based on a non-contact laser-optical displacement measurement (optoNCDT 1605.10 from MicroEpsilon) The results are expressed as a ratio of the ... a spatula for disk samples and about g for extreme value samples and placed in a sample cup After the samples had been scanned under a near infrared spectrometer, the sample cup was emptied and ... in plant breeding), values of and upward are suitable for quality control analysis, and values of above are excellent, and can be used in any analytical situation RESULTS The RMS values obtained...

Ngày tải lên: 08/08/2014, 14:20

... (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg suspension ... USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the data in the figures The data were analyzed using two-way analysis of variance ... the same pattern: tarsal, metatarsophalangeal and then interphalangeal In the vehicle and nontreated arthritic group, the incidence of disease was 100% (that is, all animals in the group were affected)...

Ngày tải lên: 09/08/2014, 10:21

... longitudinal data analysis Table II Score statistics for the environmental variance (including the residual variance) for an SAD(3) + diagonal(Residual) The diagonal(Residual) is either assumed constant ... sub-diagonals and D is a diagonal matrix of the inverse of innovation variances Score and information matrices for D and L parameters can be calculated as functions of the rst and second derivatives ... a goodness-of-t measure for both the genetic and environmental parts, as well as for the variance and correlation components It was applied to the genetic milk production analysis in dairy cattle...

Ngày tải lên: 14/08/2014, 13:22

... firms, and mixed-SaaS firms Companies offering only SaaS solutions, such as Salesforce.com and DealerTrack, are categorized as pure-SaaS players Companies offering both SaaS and packaged software ... as Ariba and Oracle, are categorized as mixed-SaaS companies Other conventional software vendors are grouped as non-SaaS firms This taxonomy is an innovation of this research and is used as a ... won highly appreciation from venture capital investments (Akella and Kanakamedala 2007) In a survey about SaaS, it was discovered that companies with SaaS as their main business had a revenues...

Ngày tải lên: 06/10/2015, 20:57

... than 0.50 (Hair, Anderson, Tatham, and Black, 1998) Task Task Task Task Task Task Task Task Task Task 10 Task 11 Task 12 Task 13 Task 14 Task 15 Items He/she performs tasks that are expected ... Maklumat perjawatan dan pengisian sektor awam Putrajaya: Author Retrieved March, 2007, from http://www.jpa.gov.my/imapsa/Default.aspx?alias=www.jpa.gov.my/i-mapsa/perangkaan Malek, S (2006, August ... subjective measure of performance in tapping job performance, which is most appropriately measured based on task related and behavioral aspects Most importantly, subjective measure allows researchers...

Ngày tải lên: 11/09/2013, 11:44

... notions about pragmatics such as Contexts and Meaning, Conversational theory, 10 Politeness, Cooperative principle and Conversational implicature etc with analysis and Vietnamese data Speech act ... questionnaires These questionnaires are translated into Vietnamese for the Vietnamese My survey on a contrastive analysis of encouraging as a speech act in English and Vietnamese is an attempt ... English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, the Vietnamese...

Ngày tải lên: 26/11/2013, 13:31

... To appear in Proceedings of the 5th Conference on data Mining Las Vegas, Nevada, USA Fangtao Li, Zhicheng Zheng, Tang Yang, Fan Bu, Rong Ge, Xiaoyan Zhu, Xian Zhang, and Minlie Huang THU QUANTA ... doctoral scholarship Ester Boldrini, Alexandra Balahur, Patricio MartínezBarco, and Andrés Montoyo 2009 EmotiBlog: An Annotation Scheme for Emotion Detection and Analysis in Non-Traditional Textual ... sentences was a separate answer to a question Our future work contemplates the study of the impact anaphora resolution and temporality on opinion QA, as well as the possibility to use Answer Validation...

Ngày tải lên: 20/02/2014, 09:20

... Chapter 1.2 BASIC ARCHITECTURAL CONCEPT OF PERFORMANCE MEASUREMENT EQUIPMENT BASED ON PROTOCOL ANALYSIS As already mentioned 3GPP 32.403 describes a performance measurement metrics that can easily ... necessary protocol data as well as to compute and aggregate appropriate measurement results Nowadays even Technical Standard 3GPP 32.403 (Telecommunication Management Performance Management (PM) Performance ... of Performance Measurement 1.1.1 What is a KPI? 1.1.2 KPI Aggregation Levels and Correlations 1.1.3 Basic Approach to Capture and Filter Performance- Related Data in UTRAN 1.1.4 Performance Measurement...

Ngày tải lên: 06/03/2014, 19:20

... method was used as the only and easiest way to calculate the costs This is because it is easy to accountants as well as managers and shareholders understand the directions of costs since all of ... financial management and operation process Applying a more detailed calculation, ABC provides economists a better database with higher level of accuracies and reliabilities compare to traditional ... to access various sources of information nowadays Manual works in manufacturing has a negative relation with the number of machines that are equipped in factories For example, in the past, a car...

Ngày tải lên: 13/03/2014, 14:19

... nx is unaffected by recombination of free electrons and ions in ˙ the case that Pg Ϸ Px, even if fast In the case of asymmetric recombination, a fast initial transient is expected, whereas the ... exponential with the same decay time as in the low power limit To understand this remarkably simple result, we analyze the dynamics after the pump pulse has passed, that is, the relaxation and the ... shown as a function of pump-probe delay, along with a fitted single exponential decay and a reciprocal decay We plot both the logarithm (Upper) and reciprocal (Lower) of the signal If spontaneous...

Ngày tải lên: 16/03/2014, 15:30

... recommendations and next steps for Booshoot Gardens " The Feasibility Analysis I have worked with Booshoot Gardens as a consultant for the last months My charge was to develop a feasibility analysis ... relocation in later years was driven by the availability of raw materials in the South and the Pacific regions (see appendix C for graph) 41 By 1870, a sharp increase in demand for paper, as well ... chain listed above For example, if bamboo paper is cheaper and functions well in a variety of end products demand for bamboo paper motivates paper and pulp mills to purchase bamboo as a raw material...

Ngày tải lên: 18/03/2014, 02:20

... signaling through a novel mechanism involving nuclear accumulation of interferon regulatory factor J Virol 83, 2178–2187 Nakao K, Nakata K, Yamashita M, Tamada Y, Hamasaki K, Ishikawa H, Kato ... using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) The RNA was used for the quantitative real-time PCR and microarray analysis To generate cDNA, lg of total RNA was transcribed using a QuantiTect ... concentrations result in earlier maximal pathway activation and an increase in signal amplitude [3,4] Furthermore, alterations in the activity of a kinase or phosphatase may affect the speed of signalling...

Ngày tải lên: 23/03/2014, 03:20

... be measured non-invasively (surface electromyography, EMG) Parameters based on the amplitude of the signal such as root-mean-square value (RMS) are commonly used in e.g movement analysis to assess ... detection area was assumed to be circular The radius of the detection area (10 mm) was estimated based on [16] and [17] The simulated location of the electrode array was between the innervation zone and ... muscle is modelled as a one-layer cylindrical shape with a high axial and lower radial conductivity Fat and skin tissue is modelled as a peripheral layer (referred to as subcutaneous layer) where no...

Ngày tải lên: 19/06/2014, 10:20

... mechanical testing, and data analysis HB, RZ, and MM did the literature search, manuscript writing, figure preparation, and data analysis MP and PZ did extensive re-reading of the manuscript PZ and ... model and experimental strain at Locations to were calculated as described earlier For the Modular hip implant data (Table 1), the average differences for Locations to at axial loads of 700 and ... mm; rate = mm/min; preload = 50 N) The slope of the "ramp-up" force-displacement curve was the axial stiffness This was repeated three times, and an average value was computed Strain gage measurement...

Ngày tải lên: 20/06/2014, 04:20