rna recognition and cleavage by a splicing endonuclease 906

DNA Recognition and Cleavage by Phenyl-Benzimidazole Modified Gly-Gly-His-Derived Metallopeptides

DNA Recognition and Cleavage by Phenyl-Benzimidazole Modified Gly-Gly-His-Derived Metallopeptides

... preferential DNA cleavage sites of bleomycins via a C4’-H abstraction pathway.61 Along with DNA cleavage, the bleomycins also mediate lipid peroxidation, membrane damage and oxidative RNA degradation.61,66 ... Determination of DNA Cleavage An established plasmid DNA cleavage assay71 was employed to characterize the overall cleavage activity of these metallopeptides In such a study, supercoiled Form I DNA ... 1.3.1 DNA Intercalators Intercalation occurs when a planar, aromatic moiety slides between two adjacent stacked DNA base pairs.21 Intercalation changes the base pair spacing from 3.4 to 6.8 and induces...

Ngày tải lên: 24/08/2014, 12:58

67 172 0
Báo cáo khóa học: Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing pot

Báo cáo khóa học: Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing pot

... hydrolytic cleavage (RNAs and 7) and intron circle formation (RNAs and 6) are observed, indicating that some hydrolytic activity are still present in the full-length splicing construct compare to ... immediately frozen at )70°C Samples were separated on M urea/5% polyacrylamide gels, followed by autoradiography Computations To quantify RNA signals, phosphoimager screens were scanned after ... interactions The DiGIR2 ribozyme contains two GNRA tetra-loops; a GUAA in L6 and a GCGA in L9b (Fig 1B) To evaluate the role of L6 and L9b in 3¢-SS hydrolytic cleavage, the GNRA loops were replaced...

Ngày tải lên: 23/03/2014, 12:20

10 412 2
Báo cáo hóa học: " Research Article Pose-Encoded Spherical Harmonics for Face Recognition and Synthesis Using a Single Image" docx

Báo cáo hóa học: " Research Article Pose-Encoded Spherical Harmonics for Face Recognition and Synthesis Using a Single Image" docx

... length f has to be assumed known, which is not always available for the uncontrollable test image We take the advantage that the facial features on the frontal view mean face are available, and show ... 3D face scans For a test image at a rotated pose and under an arbitrary illumination condition, we manually establish the image correspondence between the test image and a mean face image at the ... Jacobs, “Appearance characterization of linear lambertian objects, generalized photometric stereo, and illumination-invariant face recognition, ” IEEE Transactions on Pattern Analysis and Machine...

Ngày tải lên: 22/06/2014, 19:20

18 354 0
The Chemistry of Food and Nutrition, by A. W. Duncan pdf

The Chemistry of Food and Nutrition, by A. W. Duncan pdf

... the haricots, evaporated and dried The ash was taken in each case, and the alkalinity of the water-soluble ash was calculated as potash (K2O) The quantity of water which could be poured off was ... every case the ash contained a good deal of phosphate and lime Potatoes are rich in important potash salts; by boiling a large quantity is lost, by steaming less and by baking in the skins, scarcely ... a very small quantity of glycogen (the animal equivalent of starch and sugar) and a variable quantity of fat Vegetable food differs much, but as a rule it contains a much smaller quantity of...

Ngày tải lên: 28/06/2014, 19:20

299 555 0
Báo cáo khoa học: "Management of malignant pleural effusion and ascites by a triple access multi perforated large diameter catheter port system" ppt

Báo cáo khoa học: "Management of malignant pleural effusion and ascites by a triple access multi perforated large diameter catheter port system" ppt

... oncologic aspect MEH participated to manuscript draft and literature research PM encouraged the case report, participated in its preparation and helped to draft the manuscript All authors read and approved ... was realized under standard balanced general anaesthesia (Additional files 1, 2, and 3) A Celsite T203J (B Braun Medical SA, Sempach, Switzerland) port system with multi perforated large diameter ... port was implanted and he received three cycles of chemotherapy (Vinblastine, Dacarbazine and Cisplatine) This measure also failed and the patient required peritoneal paracentesis and thoracentesis...

Ngày tải lên: 09/08/2014, 07:21

4 339 0
báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

... each treatment on each genotype at each temperature was tested separately by using a one way analysis of variance (ANOVA) Mean separation was done by student’s t-test Data processing and statistical ... not caused by a mutation in CaARF8 Similar to tomato and Arabidopsis, a mutation in the ARF8 gene might lead to the parthenocarpic phenotype in Line Sequence analysis was performed for a contiguous ... size C annuum has an axillar placenta where ovules develop in a gradient from top to bottom The majority of the ovules are anatropous and unitegmic, as is characteristic for the Solanaceae family...

Ngày tải lên: 11/08/2014, 11:21

15 374 0
Báo cáo y học: " Foreign body granuloma in the anterior abdominal wall mimicking an acute appendicular lump and induced by a translocated copper-T intrauterine contraceptive device: a case report" docx

Báo cáo y học: " Foreign body granuloma in the anterior abdominal wall mimicking an acute appendicular lump and induced by a translocated copper-T intrauterine contraceptive device: a case report" docx

... of iatrogenic perforation and migration Afr J Reprod Health 2003, 7(3):117-123 Mittal S, Gupta I, Lata P, Mahajan U, Gupta AN: Management of translocated and incarcerated intrauterine contraceptive ... can detect these migrations early Easily available plain X-ray of abdomen and pelvis may be the simplest tool for early detection of a migrated IUCD and thereby avoid diagnostic difficulties and ... for anesthesia and postoperative recovery Critical review and submission was carried out by SHH All five authors read and approved the final manuscript References Ohana E, Sheiner E, Leron E, Mazor...

Ngày tải lên: 11/08/2014, 17:21

3 418 0
Báo cáo y học: "Inhibitory effects on HAV IRES-mediated translation and replication by a combination of amantadine and interferon-alpha" doc

Báo cáo y học: "Inhibitory effects on HAV IRES-mediated translation and replication by a combination of amantadine and interferon-alpha" doc

... combination of amantadine and IFN-alpha against HAV replication were stronger than those by amantadine or IFN-alpha monotreatment IFN-alpha was more effective than amantadine against the HAV replicon ... Tomoko Kiyohara, Tatsuo Kanda and FI analyzed data and wrote the manuscript Tomoko Kiyohara, KI and TW contributed to experiments using a whole HAV virus Tomoko Kiyohara, Tatsuo Kanda and VG contributed ... combination of amantadine and IFN-alpha can suppress HAV replication more effectively than amantadine or IFN-alpha alone Abbreviations HAV: hepatitis A virus; IRES: internal ribosomal entry site;...

Ngày tải lên: 12/08/2014, 01:21

5 301 0
Báo cáo y học: "Inhibition of HIV-1 integrase nuclear import and replication by a peptide bearing integrase putative nuclear localization signal" pot

Báo cáo y học: "Inhibition of HIV-1 integrase nuclear import and replication by a peptide bearing integrase putative nuclear localization signal" pot

... 5'-CCGCCATGTACAAAGAGCTCAAAAAAATCATCGGTCAG-3' BsrGI: 5'-GCGGTATGTACACCAGCAGAGTAACCACCGATAC-3' The resultant DNA products were cloned into pBS-yEGFP, resulting in pBS-yEGFP-NLS-IN, which was digested by ... supernatant was then centrifuged at 8000 g and separated into supernatant (cytoplasm) and pellet (nuclei) and stored at -70°C Quantitation of total and nuclear viral DNA Total viral DNA was estimated ... DraI site, to facilitate screening The primers used were: 152-IN: 5'-CCCGCAGTCTCAGGGTGTTGTTTAAACTATGAACAAAGAGCTC-3' 180-IN: 5'-CCGCGGTTCAGATGGCTGTTTAAACCACAA CAAGAAACG-3' Construction of plasmids...

Ngày tải lên: 12/08/2014, 23:22

16 292 0
Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

... 5¢-CTTCACCTGGAGGAGATTTCC AAA-3¢ for 5¢ RACE and N34S 5¢-GGGAGGGTC TCGGCGTCAACAAAC-3¢ for 3¢ RACE Nested PCR was performed using internal oligonucleotides S10 5¢-GT CGAGATGTTGGTTGTCGGAGACC-3¢ for 5¢ RACE and PR2AS ... in human malaria parasites is predominantly by a long-patch pathway Biochemistry 39, 763–772 Haltiwanger, B.M., Karpinich, N.O & Taraschi, T.F (2000) Characterization of class II apurinic/apyrimidinic ... Toxoplasma gondii Mol Biochem Parasitol 99, 223–235 Pang, Q., Hays, J.B & Rajagopal, I (1993) Two cDNAs from the plant Arabidopsis thaliana that partially restore recombination proficiency and DNA-damage...

Ngày tải lên: 08/03/2014, 22:20

9 421 0
Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx

Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx

... and RNA synthesis in reactions programmed with PV transcript RNA Translation RNA- replication reactions were carried out, as described in Materials and Methods The viral RNA template was replaced ... ribozyme-treatment (Fig 8A, compare lanes and and also lanes and 4, respectively) Previous studies have demonstrated that in the in vitro translation -RNA replication system the amount of plus strand RNA ... centrifugation, resuspended in 50 µl HeLa S10 translation/replication reaction mixture without viral RNA, and incubated for 11 hr at 34°C Plus and minus strand RNA synthesis Plus and minus strand RNA...

Ngày tải lên: 19/06/2014, 08:20

19 489 0
Báo cáo y học: " RNA silencing and HIV: A hypothesis for the etiology of the severe combined immunodeficiency induced by the virus" pot

Báo cáo y học: " RNA silencing and HIV: A hypothesis for the etiology of the severe combined immunodeficiency induced by the virus" pot

... Figure RNA silencing by HIVaINR antisense RNA RNA silencing by HIVaINR antisense RNA MicroRNAs (miRNAs) and small interfering RNAs (siRNAs) could be processed from the HIVaINR antisense RNA[ 14] and ... with miRNAs and Dicer and the mammalian orthologues of Argonaute (AGO) [73,75] Whether HAAmiRNA targeting human mRNA for FMRP results in translational repression or cleavage of the human mRNA for ... E HAAmiRNA 1:IL-2Rgamma (common chain) IL-2Rg HAAmiRNA Figure Proposed HAAmiRNA human target genes Proposed HAAmiRNA human target genes (A) Complementary base-pairing between the HIVaINR antisense...

Ngày tải lên: 13/08/2014, 05:21

13 301 0
Báo cáo y học: "Creation and disruption of protein features by alternative splicing a novel mechanism to modulate function" docx

Báo cáo y học: "Creation and disruption of protein features by alternative splicing a novel mechanism to modulate function" docx

... tract binding protein by alternative splicing leading to nonsense-mediated decay Mol Cell 2004, 13:91-100 Garcia-Blanco MA, Baraniak AP, Lasda EL: Alternative splicing in disease and therapy Nat ... information The following additional data are available with the online version of this paper Additional data file is a table listing the TM domains that are encoded by two exons Additional data ... second TM domain In general, any EST-based approach is hampered by the bias of publicly available EST databases towards cancer-related tissues or cell lines that may exhibit aberrant splicing [25,26]...

Ngày tải lên: 14/08/2014, 14:21

8 252 0
Functional diversity of cav1 3 channels generated by RNA editing and alternative splicing

Functional diversity of cav1 3 channels generated by RNA editing and alternative splicing

... 5’-CGGAGGGAAGTTCAATTTCGATGAGACACAGACTCGTCATTATCCTTATG ATGTTCCTGATTATGCTGTTACTTTTGATG -3’; HA oligo reverse:   29 5’-TGTGGGAAGTTGTCGAAGGTGCTTCGCTTGGTTTGCATTTCATCAAAAGT AACAGCATAATCAGGAACATCATAAGGATA -3’; Subsequently ... forward: 5’- TCTGAAGCAATTCTGaTTTAGGGTGGTGGCA-3’; M1 reverse: 5’- TGCCACCACCCTAAAtCAGAATTGCTTCAGA-3’ M2 forward: 5’- ATTCTGAAGCAATTCaGTTTTAGGGTGGTGG-3’; M2 reverse: 5’- CCACCACCCTAAAACtGAATTGCTTCAGAAT-3’ ... CCACCACCCTAAAACtGAATTGCTTCAGAAT-3’ M3 forward: 5’- CAGAATATTCTGAAGTAATTCTGTTTTAGGGT-3’; M3 reverse: 5’- ACCCTAAAACAGAATTACTTCAGAATATTCTG-3’ Transfection of HEK293 cell and assay for editing level HEK...

Ngày tải lên: 10/09/2015, 08:26

119 302 0
DMF Decomposition and Nitrogen Removal Performance by a Mesh-Filtration Bioreactor under Acidic Conditions

DMF Decomposition and Nitrogen Removal Performance by a Mesh-Filtration Bioreactor under Acidic Conditions

... (2005) Standard method for examination of water and wastewater, 21st ed [16] Japanese Standards Association (1998) Japanese Industrial Standards, JIS K0102 [17] Tarre, S., Beliavski, M., Denekamp, ... of metabolically active bacteria in activated sludge, Microbial Environ., 19, 61- 70 [15] American Public Health Association, American Water Works Association and Water Environmental Federation, ... nitrification and denitrification at pH than activated sludge, suggesting that acidophilic heterotrophic and nitrifying bacteria had become acclimated in the reactor Characterization of the unique bacteria...

Ngày tải lên: 05/09/2013, 09:38

8 434 0
A study of politeness strategies in requests in the course book ''streamline english departures and connections'' by b hartley & p viney

A study of politeness strategies in requests in the course book ''streamline english departures and connections'' by b hartley & p viney

... maxims are applied in illocutionary act by Leech as: Tact maxim and Generosity Maxim as directives and commissives; Approbation Maxim as expressives and assertives; Modesty Maxim, Agreement maxim ... politeness as forms of behavior that establish and maintain comity That is the ability of participants in a social interaction to engage in interaction in an atmosphere of relative harmony In stating ... to act The two aspects of face are the basic wants in any social interaction, and so during any social interaction, cooperation; cooperation is needed among the participants to maintain each...

Ngày tải lên: 14/12/2013, 00:41

68 717 6
Tài liệu Central bank governance and financial stability: A report by a Study Group doc

Tài liệu Central bank governance and financial stability: A report by a Study Group doc

... financial stability related mandates on the x-axis against the clarity of financial stability objectives in the law or in extraBIS: Central bank governance and financial stability Financial stability ... financial stability – S Oosterloo and J de Haan (2006), “Central banks and financial stability: a survey”, Journal of Financial Stability, No BIS: Central bank governance and financial stability ... Role of Macroprudential Policy” Paper The availability of information and analytical capacity to perform the mandate Serving as lender of last resort and exercising a macroprudential mandate requires...

Ngày tải lên: 16/02/2014, 10:20

91 725 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR ... they are treated with IFN-c, we can tentatively conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic...

Ngày tải lên: 18/02/2014, 08:20

11 558 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

... DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC CTTAGC was synthesized A 100 ng sample ... Industrial Science and Technology, MITI, Japan, and of an STA fellowship from the Science and Technology Agency of Japan This study was also supported partially by a grant issued by the National Natural ... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and...

Ngày tải lên: 18/02/2014, 13:20

10 464 1
w