risk assessment to phycotoxins in a recreational shellfish harvester apos s subpopulation
NOVEL APPROACHES AND THEIR APPLICATIONS IN RISK ASSESSMENT doc
Ngày tải lên :
28/06/2014, 10:20
... Dynophisis spp and Prorocentrum spp (Hallegraeff, 2003) Historically, OA A Practical Example of Risk Assessment Risk Assessment to Phycotoxins in a Recreational Shellfish Harvesters Subpopulation and ... Environmental and Ecosystem Quality A Practical Example of Risk Assessment Risk Assessment to Phycotoxins in a Recreational Shellfish Harvesters Subpopulation Cyndie Picot and Alain-Claude Roudot Laboratoire ... contamination are missing This led us to study, in the same geographical area, shellfish consumption by humans and shellfish contamination by A Practical Example of Risk Assessment Risk Assessment...
- 354
- 861
- 0
Tài liệu Báo cáo " Climate change adaptation from small and medium scale hydropower plants: A case study for Lao Cai province " doc
Ngày tải lên :
13/02/2014, 12:20
... Atmospheric-Ocean Global Circulation Models, are used to assess climate change impacts in Lao Cai Province, namely: Baseline scenario using the historical data and simulating the climate during ... floods occur due to high rainfall, on near saturated soil in steep terrain, and construction of the hydropower plants are not likely to protect against these factors Based on these assessments a scale ... stakeholders (targeted and others), and to assess the overall result anticipated by each of the main transmission channels which are: prices, employment, transfers, access, authority and assets Important...
- 9
- 546
- 0
Tài liệu Báo cáo khoa học: "Acquiring Lexical Generalizations from Corpora: A Case Study for Diathesis Alternations" pdf
Ngày tải lên :
20/02/2014, 19:20
... nouns in the corpus) Gsearch outputs all corpus sentences containing substrings that match a given syntactic query Given two possible parses that begin at the same point in the sentence, the parser ... Statistical Approaches to Language, pages 49-66 MIT Press, Cambridge, MA Hoa Trang Dang, Karin Kipper, Martha Palmer, and Joseph Rosenzweig 1998 Investigating regular sense extensions based on intersective ... alternations can be identified in corpus data via shallow syntactic processing Alternating verbs were acquired from the BNC by using Gsearch as a chunk parser Erroneous frames were discarded by applying...
- 8
- 483
- 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
Ngày tải lên :
18/06/2014, 18:20
... ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA ... use of such primers makes it unlikely that HBV strains are missed due to sequence variations and allows furthermore search for quiasispecies as well as genotype-unknown HBV strains Our approach ... that HBV strains are missed due to sequence variations and allows further search for quasispecies as well as unknown HBV genotypes and other subtypes Results Identification of candidate regions...
- 7
- 404
- 0
Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx
Ngày tải lên :
20/06/2014, 01:20
... ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA ... use of such primers makes it unlikely that HBV strains are missed due to sequence variations and allows furthermore search for quiasispecies as well as genotype-unknown HBV strains Our approach ... that HBV strains are missed due to sequence variations and allows further search for quasispecies as well as unknown HBV genotypes and other subtypes Results Identification of candidate regions...
- 7
- 566
- 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
Ngày tải lên :
05/09/2013, 09:08
... were classified as transportation land use in the SCAG data and USGS classification system Vegetated areas inside the institutional areas were also identified as low pollutant loading areas, which ... classified as public land use in the SCAG data and USGS classification system Recreational facilities including parks were also classified as low pollutant loading areas, which were often categorized ... spectral bands and geospatial ancillary data, the coordinate values of each pixel, as inputs since geospatial ancillary data improves accuracy (Park and Stenstrom, 2003) We classified stormwater...
- 7
- 575
- 0
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
Ngày tải lên :
05/09/2013, 09:08
... sources and practices about drinking water, types of latrines, cost and financial aspects, local community participation, hygiene practices, and other water and sanitation issues Participatory data ... international NGOs They helped the local people to install the biogas options by sharing a part of the installation cost Biogas plant sewerage system in Bauniabad Based on the results of the test plants, ... biogas plant system continuously, it is necessary to establish the operation and maintenance system including the maintenance cost sharing by the local people At this stage, it is still impossible...
- 9
- 971
- 0
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
Ngày tải lên :
27/12/2013, 20:26
... learning style preferences and needs, planning for an L2 task, gathering and organizing materials, arranging a study space and a schedule, monitoring mistakes, and evaluating task success, and 27 evaluating ... well as the language As a language is used as a means of communication, the social strategies are needed There are sets of social strategies are asking questions to get verification of a confusing ... texts such as conversations, dialogues, jokes, lectures, news broadcasts, song, narratives, etc Each type has its own characteristics to transfer information to listeners dissimilarly Based on...
- 99
- 805
- 0
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx
Ngày tải lên :
22/02/2014, 09:20
... Brazilian Aracruz Yes 0.56% 3.32% Graduates: 10 Masters and doctors: 12 Klabin Yes 0.09% 0.30% Graduates: 19 Masters and doctors: Ripasa Yes 0.12% 0.40% Graduates: Masters and doctors: Suzano ... 2.54% Graduates: Masters and doctors: Rigesa Yes - - Graduates: 13** Masters and doctors: Graduates: 19 Masters and doctors: 3.3 Mean - 0.40% 1.72% Number of graduates and posgraduates by company: ... Technological spillovers: supply nationality Companies Brazilian Aracruz Klabin Ripasa Suzano Bahia Sul Votorantim Mean Foreign Cenibra International Paper Norske Skog Rigesa Mean Made in Brazil by Brazilian...
- 23
- 894
- 0
capital management in vietnam’s shipbuilding industry, applying accounting policy, supplying relevant information for financial managers a case study on vinashin (vietnam shipbuilding industry group)
Ngày tải lên :
13/03/2014, 14:20
... capital plays a vital role in business It is principle tool to gain business s goals In addition, capital respects business s relationship related to economic benefits among enterprises Capital ... cash in hand (money) and bank accounts and credits Financial managers manage cash to ensure that it is always available for meeting the company s day -to- day transactions and debts 2.1.2.2.Classification ... may cause from the shortcomings of VINASHIN s management of capital Therefore, in chapter of this thesis, a real case of VINASHIN will be use for analysis as particular example of capital management...
- 86
- 478
- 0
Combining AHP with GIS for Predictive Cu Porphyry Potential Mapping: A Case Study in Ahar Area (NW, Iran) doc
Ngày tải lên :
16/03/2014, 23:20
... Physico-chemical controls of alteration and mineralization at the Sungun Porphyry Copper Deposit, Iran In Geological Association Canada—Mineralogical Association Canada (GAC-MAC) Annual Meeting ... the Sungun Porphyry Copper Deposit, Iran In Geological Association Canada—Mineralogical Association Canada (GAC-MAC) Annual Meeting (Vol 50, p A- 67), Ottawa Hezarkhani, A. , Williams-Jones, A E., ... multiclass evidential maps in a flexible and consistent way A qualitative and quantitative knowledge of the spatial association between known mineral occurrences and geologic features in an area is...
- 12
- 411
- 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf
Ngày tải lên :
17/03/2014, 11:20
... data, GIS data and satellite imagery data) • The zonation can be regarded as a tool for sustainable agricultural development in the watershed area 17 Suggestion zones for sustainable of watershed ... area, and than this place was changed in dynamics way of land use system • The forest area was destroyed by increasingly shifting cultivation and rubber plantation areas • Lack of an appropriate ... Contents Introduction Statement of problems Objectives Materials and Methods Study area Results and Discussions Conclusions Introduction • In the last decade, in Laos GIS and Remote sensing (RS) has...
- 24
- 897
- 0
Báo cáo " ISO 14001 ENVIRONMENTAL MANAGEMENT SYSTEM FOR UNIVERSITIES: A CASE STUDY AT HO CHI MINH CITY UNIVERSITY OF TECHNOLOGY IN VIETNAM " pptx
Ngày tải lên :
22/03/2014, 09:20
... organizational alignment with sustainability and assesses leading edge practices The study recommends altering Housing s current mission statements as well as creating a freestanding sustainability ... mission statement The study includes sustainability assessments of 11 operational and decision-making areas The assessments extend beyond traditional environmental audits by developing sustainability ... solid waste generated from offices, classrooms and campus include surplus food, carton, papers, package, can, leaves, etc and also a small amount of hazardous waste such as batteries, fluorescent...
- 12
- 753
- 0
Global virtual teams for value creation and project success: A case study docx
Ngày tải lên :
29/03/2014, 23:20
... practices and holiday seasons across the organisation also meant that there was always someone on holiday and emails stood waiting for his/her return The consensus amongst informants was that ... budget and functionality, (2) meeting user requirements and satisfaction, and (3) project team satisfaction and self-assessed success Data was unavailable to evaluate suppliers’ satisfaction and ... probable issues with virtual teaming, individuals as ‘doers’ are more pragmatic and Table Maintaining roles, managers and other projects Informants A B C D E F G H I J K Total ‘Yes’ Same role Same...
- 12
- 661
- 0
báo cáo sinh học:" Sustainable scaling up of good quality health worker education for tuberculosis control in Indonesia: a case study" doc
Ngày tải lên :
18/06/2014, 17:20
... centers, lung clinics, hospitals, etc.) Figure Cascade1training Cascade training NTP: National Tuberculosis Control Programme NTC: National training coordinator PTC: Provincial training coordinator ... for quality assurance of training courses The training methodology included an ongoing assessment of participants through exercises, discussions, and observations Development of a national resource ... develop and revise (as necessary) training guidelines, curricula and modules for both pre- and in- service training and education; conduct training needs assessments; ensure annual planning for...
- 9
- 417
- 0
báo cáo sinh học:" Rebuilding human resources for health: a case study from Liberia" docx
Ngày tải lên :
18/06/2014, 17:20
... opportunities, salary incentives and technical assistance is credited as creating greater numbers of qualified nurses Second, standardizing NGO salaries to match MOHSW pay amounts has stopped a large ... housing and increased salaries to develop national strategies for retaining and improving staff in counties outside of Montserrado Additionally, MOHSW has started using performance-based financing ... (DCE) and training institution studies, the paper evaluates the success in increasing the nursing workforce as well as the ongoing challenges around redistribution to hard -to- reach areas, training...
- 10
- 364
- 0
báo cáo hóa học:" Integration of HIV/AIDS services into African primary health care: lessons learned for health system strengthening in Mozambique a case study" pdf
Ngày tải lên :
20/06/2014, 08:20
... hospitals be phased out and tasks integrated into existing pharmacies Provincial and district pharmacists received additional training to integrate the distribution of antiretrovirals (ARVs) into ... staff, including doctors, nurses, physicians’ assistants and administrative staff, had been placed in the day hospitals to focus on ART 2005-2008: Integration and decentralization of HIV/AIDS services ... centres alongside existing hospital compounds Day hospitals included their own pharmacies, data systems, health workforce, waiting areas and receptions Using this separate infrastructure, patients...
- 9
- 400
- 0
Báo cáo hóa học: " Comparison of four different methods for reliability evaluation of ecotoxicity data: a case study of non-standard test data used in environmental risk assessments of pharmaceutical substances" pdf
Ngày tải lên :
21/06/2014, 03:20
... environmental risk assessments of pharmaceutical substances Accepting non-standard test data is likely to increase the regulatory agencies’ work load since it is more complicated to evaluate these data ... ensure a scientifically well-founded environmental risk assessment of pharmaceuticals To enable the use of non-standard tests in risk assessments, two things are needed: that the legislation is ... Agency), ASTM (American Society for Testing and Materials), AFNOR (Association Française de Normalisation), and ISO (International Organization for Standardization) The test standard establishes a uniform...
- 15
- 1K
- 0