... peak height was chosen to be used as it showed the best correlation All analysis was done in duplicates Titratable acidity The titratable acidity was measured by titrating a mixture of g of sample ... 1/10 to make a laboratory scale, see appendix Materials and methods Materials Cereal grains Commercial quality wheat flour of 70% extraction rate designated as "bagerivetemjöl" was obtained from ... German salami (smoked), Italian salami, Lebanon bologna (sausage), Longaniza (sausage), and Teewurst are typical fermented meat products of Europe While paak made of fish and cereal by lactic acid...
Ngày tải lên: 24/03/2014, 04:20
... 04688945001 TACTGCCCCACCATGACC CACGGCGTAGGAGACCAC GNRH1 #29 Roche Diagnostic, Cat No: 04687612001 GACCTGAAAGGAGCTCTGGA CTTCTGGCCCAATGGATTTA HPRT Human HPRT Gene Assay (Roche Diagnostic, Cat No: 05046157001) ... computer application software 4.05 dedicated for the LightCycler 2.0 All data was analyzed using the Statistica Software ver 6.0 (StatSoft, Poland) The Mann-Whitney U test was performed and the ... transcriptase-polymerase chain reaction assay Acta Biochim Pol 2004, 51:747-755 25 Turner RR, Giuliano AE, Hoon DS, Glass EC, Krasne DL: Pathologic examination of sentinel lymph node for breast...
Ngày tải lên: 18/06/2014, 22:20
báo cáo khoa học: " Whither RDS? An investigation of Respondent Driven Sampling as a method of recruiting mainstream marijuana users" pdf
... adaptations, nonrandom methods of selection are criticized as biased insofar as certain segments of the population are inaccessible for sampling [25] Other common forms of bias are demographic sameness, ... sampling and snowball/ chain-referral that can yield large samples yet offer no assurance of the representativeness of findings Targeted (in time/space or venue-based) sampling are variations often used ... marijuana more than once a week on average (half of whom used daily) in the last 30 days To augment the analysis of demographic profiles, in contrast to MRDS and random phone recruitment, a study...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx
... clearly identifiable segmental and sub-segmental airways A separate score was given to each lobe Scores ranged from to was normal wall thickness, was minimal wall thickening, was bronchial wall ... from asthmatics [7] HRCT scans were loaded to a PACS workstation (mv1000, Siemens) and all images were analysed electronically A magnification factor of was applied in all images that were displayed ... half of the diameter of the adjacent blood vessel, was bronchial wall thickness half to the same diameter of the adjacent vessel, and was bronchial wall thickness greater than the diameter of...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo y học: " Microfinance as a method of facilitating research in emergency medicine" ppsx
... article as: Hallas et al., Microfinance as a method of facilitating research in emergency medicine Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2010, 18:23 Page of ... attempts to place intraosseous cannulas from a total of 732 Scandinavian health care workers Analysis of the data is pending Having data on so many attempts of intraosseous access, is seems unprecedented ... properly cited Scandinavian Journal of Trauma, Resuscitation and article is et al; licensee http://www.sjtrem.com/content/18/1/23 Hallas et al Scandinavian Journal of Trauma, Resuscitation and Emergency...
Ngày tải lên: 13/08/2014, 23:21
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... those at risk of heart failure found that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... was to compare a tango dance class, considered a novel movement intervention, with a standard community exercise class The results illustrate improvements in all measures of falls, gait and balance...
Ngày tải lên: 28/03/2014, 20:20
báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc
... larger datasets and results of ongoing adjuvant trials are needed to provide confirmatory evidence for or against the concept and feasibility of withdrawal therapy in locally advanced and metastatic ... Segaloff A, Rubens RD: Assessment of response to therapy in advanced breast cancer: a project of the Programme on Clinical Oncology of the International Union Against Cancer, Geneva, Switzerland Cancer ... breastinternationalgroup.org/LinkClick.aspx?fileticket=dmcZc0avwBc% 3d&tabid=2341] doi:10.1186/1477-7819-9-101 Cite this article as: Agrawal et al.: Clinical relevance of “withdrawal therapy” as...
Ngày tải lên: 09/08/2014, 02:21
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
... ratings of motion sickness as often as possible, it is always a trade-off between asking many or few questions to obtain a valid measurement of the perceived state The NoFix slope increased as ... the variation in ST was large, and hence approximately half of the subjects terminated the tests before 50% of the maximum time had passed Outcome data were analysed using a slope calculated as ... for and a weak but significant positive correlation was found for NoFix, indicating that subjects reporting a large increase in Mal scores over time also increased their actual number of fixations...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt
... clones of oak it was necessary to allow for shoot length which was very variable and has a close relation- decapitation ship with numbers of buds and branches (Ward, 1964; Harmer, 198 9a; 199 2a) Similar ... active was assessed at 8-d intervals — — — At the end of the first period of growth the number of lateral branches on the original shoot was counted before removing all new ... (Harmer, 198 9a, 199 2a) analyses of these data used length as a covariate; any levels of significance given in the text, tables or figures result from these analyses However, the means and standard errors...
Ngày tải lên: 08/08/2014, 19:21
Using the delphi method as a form of assessment
... ("agree"); median was also 3.0 Alumni survey response average for question 3, "have adequate computer skills" was 3.64 ("agree"); median was also ("strongly agree") Interns' overall ability was ... average for question 2, "be aware of important ethical considerations in the construction industry" was 3.29 ("agree"); median was also 3.0 Interns' overall ability was 4.27 Satisfactory performance; ... effectively" was 3.07 ("agree"); median was also 3.0 Interns' overall ability was 4.27 Construction management graduates need improvement in grammar; there are additional indications that they also need...
Ngày tải lên: 24/10/2014, 00:07
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
... chloride (PAC) as well as waste steel slag (WSS) (E5) A natural tidal flat (C3) at the same tidal level was chosen as a reference for monitoring benthic communities as well as physicochemical characteristics ... in artificial tidal flats in Japan, a growth test of R philippinarum was also carried out in DS mixtures MATERIALS AND METHODS Artificial tidal flats in real seashore Five artificial tidal flats ... have the same physicochemical and biological structures as natural tidal flats, and that silt accumulation in the sediment is a key parameter for the creation of a natural-like artificial tidal...
Ngày tải lên: 05/09/2013, 09:38
Reading Theory as a Microcosm of the Four Skills
... Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely central Even with as few details as we ... predominantly lie in the area of reading University systems in Europe, unfortunately, are dominated by the grammar-translation method of language teaching, where, as often as not, English is only taught ... is in their emphasis It is my belief that in giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, we, as teachers give the...
Ngày tải lên: 06/09/2013, 10:10
Social Phobia as a Consequence of Brain Defects
... (accepting) accepting and negative and neutral expresssions: activation accompanied by in amygdala, evaluation of: hippocampus, Task performance: parahippocampal recognition of gyrus, medial type of emotion ... of angry or neutral facial expressions accompanied by evaluation of: Task performance: recognition of type of emotion present in stimulus Stimulus rating for valence and arousal Task performance: ... physical signs with imbalances in autonomic neurotransmission In this formulation, the physical complaints typical of social phobia, are associated with rapid release of catecholamines (noradrenaline,...
Ngày tải lên: 01/11/2013, 08:20
Social Phobia as a Consequence of Cognitive Biases
... questionnaire are unavailable, as are most elements of validity For now, it is hard to tell what exactly the CSAQ is a measure of Fear of Negative Evaluation (FNE: Watson & Friend, 1969) As the SAD (reviewed ... treated as if originating in a scale of equal intervals This violates the basic postulates of the analysis of variance The relevant data should have been properly treated through some form of ... instance of a ‘‘category mistake.’’ According to Ryle (1949) this logical fallacy consists of treating the label for a class of events as if it were a member of that class From this vantage point...
Ngày tải lên: 01/11/2013, 08:20
Social Phobia as a Consequence of Inadequate Social Skills
... definitions aside, I shall now consider how the construct of social skills has been assessed in research Assessment of Social Skills of Social Phobic Individuals As the assessment of social skills had ... value of matching treatment with patients’ patterns of fear Based on extreme responses to a role-play and a ‘‘rationality’’ test, 39 patients were classified as either predominantly behavioral ... consider social phobia not as a breakdown in social ability but as emerging out of a pattern of meaningful actions that constitute a means to an end Although not necessarily abnormal in themselves,...
Ngày tải lên: 01/11/2013, 08:20
Social Phobia as a Consequence of Individual History
... reassessed after years Measures included both observation of the child at play in the laboratory, assessment of classroom (shy, anxious) behavior by the teacher as well as peer assessment of ... appeasement and avoidance of conflict typical of social phobic individuals Parental Alcoholism David et al (1995) found an association between parental alcoholism and phobia (both social and agoraphobia); ... variables such as maternal anxiety and an array of variables indexing temperament Nonetheless, it must be borne in mind that an even greater proportion of infants classified as anxiously attached...
Ngày tải lên: 01/11/2013, 08:20
Social Phobia as a Disorder of Social Anxiety
... (mean age 12) on a social phobia and anxiety inventory for children (SPAI-C) and on a behavioral assessment task This included an interaction with a peer as well as reading aloud in front of an ... the validity of the measures devised to ascertain and quantify social anxiety, as this is most relevant to social phobia Examination of the validity both of the construct and of the methods assessing ... anywhere The danger was manifest to the senses only in the alarming information disseminated by various media While anthrax is not contagious, fear (or anxiety) as well as courage clearly are Vast numbers...
Ngày tải lên: 01/11/2013, 08:20
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... have a great tendency to attract the attention of students that other forms of the mass media lack According to Subramaniyan A Nambiar (1985), “ Even the person who is totally tone deaf may at ... The time for the test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed ... class A However, the comparison of the modes reveal that the class B seems to be better than class A as its modes of six is higher than the one of class A which is five -Correlation: N Class A...
Ngày tải lên: 29/01/2014, 10:33