... CATGGCCCGATGGCGCTCTGTTG N7-F M-F AGCRAAAGCAGKTAG AGTAGAAACAAGGTARKTTTT NS-F CAAAAACATAATGGATYCCAACACK NS-R NS GCATTTTACGAAAAGTATTGGATTTG M-R M GTGATCGAGAATGAATCCAAATCAGA N7-R ATTAAATAAGCTGAAAMGAGA A ... ATATCGTCTCGTATTAGTAGAAACAAGGTACTT HA-F1 GCAAAGCAGGGGTCACAATGTCA HAR1 HA ATATCGTCTCGTATTAGTAGAAACAAGGCATTT PA-R1 PA ARATACCNGCAGARATGCT PB1-R2 TCTGAATCAGCCATGTCAATTGT HA-F2 NP-1F AGCRAAAGCAGGGTDKATA CYARTTGACTYTTRTGTGCTGG ... CYARTTGACTYTTRTGTGCTGG NP-2F TAYGACTTTGARAGAGAAGG NP-2R AGTAGAAACAAGGGTATTTT N4-F AGCAAAAGCAGGAGTTTCATAATGA N4-R NA GGGTGTTTTTAACTAAATACAGATTGTGC NP-1R NP GATTTCCATTGGACGATGGTACAACCA HA-R2 CATGGCCCGATGGCGCTCTGTTG...
Ngày tải lên: 12/08/2014, 04:20
... regulatory factors Clin Diagn Lab Immunol 9, 530–543 26 Funatogawa, K., Matsuura, M., Nakano, M., Kiso, M & Hasegawa, A (1998) Relationship of structure and biological activity of monosaccharide ... American Type Culture Collection (Manassas, VA, USA) and maintained in our laboratory, was also used For cell culture, RPMI-1640 (Dainippon Pharmaceutical Co Ltd, Osaka, Japan) supplemented with ... (5¢-GGA AGC GAA AAT GAA ATT GAC T-3¢) were constructed as probes for EMSA The oligonucleotides were annealed and labeled with [32P]dCTP[aP] Binding reactions were performed (20 lL of the total volume)...
Ngày tải lên: 17/03/2014, 10:20
a path with heart - a guide through the perils and promises of spiritual l- jack kornfield
... silent retreat in one room, sitting and walking for twenty hours a day I was offered excellent teachings in great monasteries led by Mahasi Sayadaw, Asabha Sayadaw, and Achaan Buddhadasa I learned ... can choose a path with heart Sometimes it takes a shock to awaken us, to connect us with our path Several years ago I was called to visit a man in a San Francisco hospital by his sister He was ... civilizations, arise and pass away Take the one seat of a Buddha and rest with a heart of equanimity and compassion in the center of it all Sit this way, dignified and present, for as long as you...
Ngày tải lên: 11/06/2014, 12:01
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... Riazalhosseini Y, Yazdan H, Arzhangi S, Jalalvand K, Ebrahimi A, Kazemi S, Smith RJ, Najmabadi H: The frequency of GJB2 mutations and the Delta (GJB6-D13S1830) deletion as a cause of autosomal ... Brownstein Z, Marlin S, Adina Q, Cockburn DJ, Pandya A, Siemering KR, Chamberlin GP, Ballana E, Wuyts W, Maciel-Guerra AT, Alvarez A, Villamar M, Shohat M, Abeliovich D, Dahl HH, Estivill X, Gasparini ... MR, Marlin S, Pandya A, Shahin H, Siemering KR, Weil D, Wuyts W, Aguirre LA, Martín Y, MorenoPelayo MA, Villamar M, Avraham KB, Dahl H-HM, Kanaan M, Nance WE, Petit C, Smith RJH, Van Camp G, Sartorato...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo khoa học: "Effects of cyclosporin A treatment on the pathogenesis of avian leukosis virus subgroup J infection in broiler chickens with Marek’s disease virus exposure" ppt
... curve analysis was done with an initial denaturation at 95oC DNA melting was accomplished with an initial temperature of 65oC for 10 seconds and a gradual temperature increase with a transition rate ... antibody and the results of histopathology was determined by Chi-square analysis, and mean tissue scores from immunohistochemistry were analyzed using KruskalWallis analysis of variance Significance ... weight and data from mitogenesis assay and flow cytometry were analyzed using two-tailed Student t-test with assumption of different variance Significance of differences in percentage of viremia, antibody...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf
... stomach, and a clinical stage E I2 was established We selected all cases reported with primary gastric large Bcell lymphoma treated with anti HP treatment and all cases of primary gastric large ... et al., [7] and Hiyama et al., [16] are a well defined subgroup characterized by clinical stage E I and presence of areas of MALT lymphoma; clinical stage is not clear in patients with high grade ... after Helicobacter pylori eradication have a common genetic pattern and if cases without areas of MALT lymphoma are transformed lymphomas or de novo lymphomas The gold standard of treatment of...
Ngày tải lên: 09/08/2014, 07:21
Báo cáo y học: " Relationships among neurocognition, symptoms and functioning in patients with schizophrenia: a path-analytic approach for associations at baseline and following 24 weeks of antipsychotic drug therapy" ppt
... Table The majority of patients were male with an average age of approximately 39 years of age The average age of onset of the disease was approximately 23.1 years of age, with a mean number of episodes ... Interpersonal Values associated with directed pathways are standardized path coefficients; values over the double-arrowed arches are correlations; asterisks indicate statistical significance at *p ... Lilly, SanofiAventis, and HoustonPharma Dr Keefe has received grant/research support from Astra-Zeneca and Eli Lilly, and NIMH He has also served as a consultant and on advisory boards for various...
Ngày tải lên: 11/08/2014, 17:20
Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx
... than a month She began having regular menstrual cycles again, and was able to maintain her weight at an appropriate level One year after discharge from the hospital, her weight was 53 kg, and ... portion of the duodenum between the SMA and the aorta [4] In our patient, SMA syndrome resulted from weight loss associated with anorexia nervosa The Diagnostic and Statistical Manual of Mental Disorders, ... create a plan that included appropriate, high-level out-patient therapy for severe anorexia along with continued medical management by both the patient's pediatrician and gastroenterologist An ability...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: "Pathophysiological aspects of hyperglycemia in children with meningococcal sepsis and septic shock: a prospective, observational cohort study" docx
... http://ccforum.com/content/15/1/R44 at 24 and 48 hours thereafter Assays were used in accordance with the instructions of the manufacturer Arterial glucose and lactate were determined on a blood gas analyzer (ABL 625; Radiometer ... metabolic acidosis (pH of less than 7.3 or base excess of not more than mmol/L or plasma lactate levels of greater than 2.0 mmol/L), (b) arterial hypoxia (partial pressure of oxygen [PO2] of ... analysis was applied to evaluate the relationship between admission hyperglycemia and various variables Data were log-transformed for multiple linear regression analysis when necessary P values of less...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... Turkish patients Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; ... 30 days; late, >30 days and very late, >1 year) Myocardial infarction was defined as a creatine kinase (CK) elevation >2 times above the upper limit of normal levels with any associated elevation ... the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety and efficacy of Paclitaxel-eluting...
Ngày tải lên: 25/10/2012, 11:18
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
... together with the input variables, control variables and state variables Considering a system element with an input variable x(t), a state variable s(t), a control variable c(t) and an output variable ... efficiency of our actions 1.2.3 Integrated management and policy analysis Integrated management Rapid changes of objectives and methodological approaches towards the management of natural resources and ... like a river or an estuary to a complete water system such as a river basin or a coastal area These changes result in integrated coastal-zone management, integrated river basin management and/or...
Ngày tải lên: 06/11/2012, 10:35
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation
... tank and a microfiltration membrane as separation apparatus The aeration tank was made from Plexiglas with a working volume of liters Air was supplied to the aeration tank through diffusers at a ... from chemical treatment is classified as a hazardous waste, so it should be treated in a proper way This means that the sludge disposal causes a substantial increase in wastewater treatment cost ... different samples at various SRT The BOD/COD of influent sample has an average of 0.66 This shows that the denimprocessing wastewater can be classified as rather easily biodegradable waste by aerobic...
Ngày tải lên: 05/09/2013, 09:08
A contrastive analysis of idioms denoting humans with dispraising implications in english and vietnamese
... RESEARCH QUESTIONS - What are the syntactic, stylistic and semantic features of grammar and have a wide range of vocabulary can absolutely use IDHDIE and IDHDIV? idioms well because the meaning of ... however, are also known as the roughest part in vocabulary acquisition that learners of a foreign language in general and semantic features of English idioms denoting humans with dispraising implication ... conducted so as to draw out some implications with particular reference to the 3.5 DATA ANALYSIS After finishing the collection of data, we qualitatively describe, analyze and compare the data in two...
Ngày tải lên: 26/11/2013, 13:31
Tài liệu Project (written version):“The problems of the “Citibus” (bus operating company) and their possible solutions. Drawing a contract.” doc
... change the cituation for better (increase the passing capacity of the roads that doesn’t cope with the growing number of cars and other carriers, build new roads and rearrange the traffic within the ... finally green – “The trip was really great” We shall inform about the action the drivers as well At the end of each month we’ll calculate how many stripes of tjose or that colour each driver has ... step we assure that both parties have had the opportunity to have this contract reviewed by their attorney (in order to avoid any infringement of the Labour Code or any other laws of Ukraine and...
Ngày tải lên: 20/12/2013, 19:15
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase (ACMSD) J Biol Chem 277, 35162–35167 Tanabe A, Egashira Y, Fukuoka SI, Shibata K & Sanada H (2002) Expression of rat hepatic 2-amino3-carboxymuconate-6-semialdehyde ... Bwanaisa L, Njobvu A, Kayira K, Turner GDH, Taylor TT et al (2003) Metabolites of the kynurenine pathway of tryptophan metabolism in the cerebrospinal fluid of Malawian children with malaria J...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx
... effects of ethanol and treatment with disulfiram Alcohol Alcohol 28, 461–468 30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto A, Yoshida A, Nakayama K, Nakayama K & Kawamoto T (2002) Diminished alcohol ... E-amino groups of lysines in MT2 were carbamoylated with potassium cyanate and the modified protein was assayed for zinc release as described above Acetaldehyde releases almost the same amount of ... Roman J, Gimenez A, Lluis JM, Gasso M, Rubio M, Caballeria J, Pares A, Rodes J & Fernandez-Checa JC (2000) Enhanced DNA binding and activation of transcription factors NF-kappa B and AP-1 by acetaldehyde...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc
... resolution of cytochrome c oxidase from Paracoccus denitrificans Nature 376, 660–669 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, ... details of the reaction of caged oxygen and cytochrome bo3 The protein was reduced with the quasi-natural substrate analog duroquinol The samples reached a stable baseline after 2–4 h at °C, and ... in the crystal (data not shown) Spectroscopical and photochemical properties of HPBC The perchlorate and nitrate salt of HPBC had identical optical absorbance spectra with maxima at 212, 304,...
Ngày tải lên: 21/02/2014, 15:20
RISK OF PULMONARY TUBERCULOSIS ASSOCIATED WITH EXOGENOUS REINFECTION AND ENDOGENOUS REACTIVATION IN A SOUTH INDIAN RURAL POPULATION-A MATHEMATICAL ESTIMATE* doc
... suggestions at the draft stage of the paper, Mrs.Anuradha for statistical assistance, Miss T.J Alamelu for secretarial help and Mr B.R Narayana Prasad graphics References Krishnamurthy, VV, Nair, SS, ... respective sizes of RI and NRI can be estimated It was estimated that among 10,565 persons (aged years and above) infected at the I survey and examined at the II survey, 415 persons had become reinfected ... new cases diagnosed at the III survey were 34, and respectively 65 the interval between III and IV surveys It was found that 64 new cases could have been diagnosed as against 57 actually diagnosed...
Ngày tải lên: 06/03/2014, 04:20