response to a change in composition through interaction with a gas

Tài liệu Biodiversity Response to Climate Change in the Middle Pleistocene ppt

Tài liệu Biodiversity Response to Climate Change in the Middle Pleistocene ppt

... Irvingtonian Unknown Probably Irvingtonian Unknown Probably Irvingtonian Unknown Probably Irvingtonian Mixed Contains specimens of potential Blancan age as well as Irvingtonian At least as old as ... its ability to maintain the baseline functions that define it Maintaining these baseline functions is, in fact, integral to an operational definition of ecosystem health In the words of Haskell ... in naturally varying systems Therefore they may be useful as an ecological baseline against which future changes can be measured As global warming continues into the coming decades, changes in...

Ngày tải lên: 17/02/2014, 20:20

409 425 0
Antibody response to influenza vaccination in the elderly: A quantitative review doc

Antibody response to influenza vaccination in the elderly: A quantitative review doc

... obtain data that may have had an impact on vaccine response, including living situation (institutionalized or community living), medical history, vaccine-specific factors such as antigen dose and ... responses to in uenza vaccination in the elderly using an immunostimulant patch Vaccine 2005;23(7):946– 50 [42] Hara M, Tanaka K, Hirota Y Immune response to in uenza vaccine in healthy adults and ... over the age of 75 We also compared the vaccine response for each individual adjustment factor related to the vaccine and study participants (vaccine: vaccine type, vaccine dosage, new vaccine component;...

Ngày tải lên: 28/03/2014, 20:20

11 484 0
báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

... blood alexa-488 labeled MCP-1 internalization assay was validated here for use in clinical trials investigating a CCR2 antagonist by examining a standard reagent concentration to use, the stability ... than 10% across all individuals and all days (Table 5) In- study results This assay was used as a pharmacodynamic marker for biological activity of a CCR2 antagonist in a clinical trial consisting ... [16] Using the guidance for ligand binding assays [12] as a foundation in which to base the validation of a flow cytometry pharmacodynamic assay and applying the "appropriate" parameters for a cell...

Ngày tải lên: 18/06/2014, 15:20

12 829 0
báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf

báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf

... MS patients' response to therapy, with a surrogate marker, may have additional value as particularly effective immunomodulatory activity, such as that observed with natalizumab, may have a potential ... Center in Shreveport and signed informed consent was obtained from all participants Measurement of soluble HLA A solid phase ELISA was used to quantitate s-HLA-I and sHLA-II in the saliva obtained ... (Figures 1A and 1B) All study subjects with RRMS had measurable amounts of sHLA-II in their saliva and in all subjects increases in saliva sHLA-II levels following treatment with IFN-β 1a (at month...

Ngày tải lên: 19/06/2014, 22:20

6 424 0
Báo cáo khoa học: "Osmotic adjustment in Pinus pinaster cuttings in response to a soil drying cycle" pptx

Báo cáo khoa học: "Osmotic adjustment in Pinus pinaster cuttings in response to a soil drying cycle" pptx

... [2] Baradat P., Pastuszka P., Le pin maritime, in: Gallais A. , Bannerot H (Eds.), Amélioration des Espèces Végétales Cultivées, INRA, Paris, 1992, pp 695–709 [3] Blum A. , Towards standard assays ... ΨΠ, and the ΨΠ value varie with both investigator and species, summarize the effects of the variations in the ln RWC/(–ln (–ΨΠ)) relationship, and are calculated by many authors as an indicator ... Osmotic adjustment in maritime pine cuttings [11] Fernandez M., Gil L., Pardos J .A. , Response of Pinus pinaster Ait provenances at early age to water supply I Water relation parameters, Ann For...

Ngày tải lên: 08/08/2014, 14:21

5 291 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps

Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps

... obtained from animals cannot always be extrapolated to humans Bjelle [36] has analysed the mechanical response of human knees and found an increase in glycosaminoglycan production in loadbearing ... protein analysis The cartilage used for RNA quantification was diced and incubated with RNAlater (Qiagen Inc., Valencia, CA, USA) overnight at 4°C prior to storage Available online http://arthritis-research.com/content/8/5/R149 ... joint loads maintain healthy cartilage with a specific protein composition according to loading demands [32,35] In contrast, inappropriate loads alter the compositional properties of cartilage,...

Ngày tải lên: 09/08/2014, 08:22

11 520 0
Báo cáo y học: "Gene expression profiling in the synovium identifies a predictive signature of absence of response to adalimumab therapy in rheumatoid arthritis" doc

Báo cáo y học: "Gene expression profiling in the synovium identifies a predictive signature of absence of response to adalimumab therapy in rheumatoid arthritis" doc

... 3'-accaatagagagaccaggaagaa-5'; GTSE1: 5'acgtgaacatggatgacccta-3' and 3'-gttcgggaaccggattattta-3'; CDC2: 5'-ggtcaagtggtagccatgaaa-3' and 3'-ccaggagggatagaatccaag-5'; and MKI67: 5'-ccccaaccaaaagaaagtctc-3' ... -actin: 5'-ggcatcgtgatggactccg-3' and 3'-ctggaaggtggacagcga-5'; LTB: 5'-gaggaggagccagaaacagat-3' and 3'-tagccgacgagacagtagagg-5'; CCL5: 5'-catattcctcggacaccacac-3' and 3'-gatgtactcccgaac- Page ... following primers: IL-7R: 5'-ttcttggaggatgcagctaaa-3' and 3'aagcccaaccaacaaagagtt-5'; IL-6: 5'-gcccagctatgaactccttct-3' and 3'-tgaagaggtgagtggctgtct-5'; INDO: 5'-ggtcatggagatgtccgtaa-3' and 3'-accaatagagagaccaggaagaa-5';...

Ngày tải lên: 09/08/2014, 14:20

13 486 0
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps

Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps

... the mean )lay o for and a and for the variance can be written separately With s i instance, b tends to introducing 2 or2 , = = = tends to infinity and if at’ than a half, and tends to 1/2 as as ... and their expressions as ratios of a covariance to a variance indicate that they can also be obtained from a linear approximation This comment makes it possible to extend easily the approximate ... means and standard deviations over generations of canalising selection Several aspects appear: with a high heritability h!, the population mean tends in a linear manner towards the optimum in a...

Ngày tải lên: 09/08/2014, 18:21

29 347 0
báo cáo khoa học: "Complete response to FOLFOX4 therapy in a patient with advanced urothelial cancer: a case report" docx

báo cáo khoa học: "Complete response to FOLFOX4 therapy in a patient with advanced urothelial cancer: a case report" docx

... Font A, Gonzalez-Larriba JL, Berrocal A, Garcia-Ribas I, Marfa X, Fabregat X, Albanell J, Bellmunt J: Gemcitabine and oxaliplatin combination: a multicenter phase II trial in unfit patients with ... Frassineti GL, Oliva C, Pacini M, De Lena M: A phase II study of gemcitabine in patients with transitional cell carcinoma of the urinary tract previously treated with platinum Italian Co-operative ... clinical trials are examining this, no treatment has been established as secondary therapy after failure of G-C or M-VAC chemotherapy Oxaliplatin is more potent than cisplatin in vitro and has...

Ngày tải lên: 10/08/2014, 22:20

4 335 0
báo cáo khoa học: "Response to imatinib rechallenge in a patient with a recurrent gastrointestinal stromal tumor after adjuvant therapy: a case report" pdf

báo cáo khoa học: "Response to imatinib rechallenge in a patient with a recurrent gastrointestinal stromal tumor after adjuvant therapy: a case report" pdf

... Cite this article as: Kang: Response to imatinib rechallenge in a patient with a recurrent gastrointestinal stromal tumor after adjuvant therapy: a case report Journal of Medical Case Reports ... tolerated, as the only adverse events experienced by our patient were grade edema, anemia and fatigue Our patient maintained a stable PR for over two and a half years after being rechallenged with ... medical editorial assistance was provided by Novartis Pharmaceuticals I thank Jinling Wu, MD, PhD, for her medical editorial assistance with this manuscript Competing interests YKK is a consultant...

Ngày tải lên: 10/08/2014, 23:20

4 224 0
Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx

Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx

... Ethical reasons also dissuaded us from performing a coronary angiograph His family history for cardiovascular events was negative A brain MRI revealed mild cortical atrophy with bilateral lacunar ischemic ... used to evaluate his macrophage response An abnormal reactivity of macrophages to LPS, exacerbated by our patient’s own serum, was found; in fact this reaction mainly caused foam cell formation ... was referred to the Department of Internal Medicine at the University Teaching Hospital in Cagliari His clinical manifestations started in 2002 with a sudden onset of neurological symptoms Magnetic...

Ngày tải lên: 11/08/2014, 12:20

5 409 0
Báo cáo y học: " Characterization of the innate immune response to chronic aspiration in a novel rodent model" ppsx

Báo cáo y học: " Characterization of the innate immune response to chronic aspiration in a novel rodent model" ppsx

... of gastric contents, which is associated with endothelial cell damage, increased capillary permeability, and scattered intraalveolar hemorrhage Several hours later, an acute inflammatory response ... fluid aspirations and with data analysis BL carried out the cytokine analysis, and helped prepare figures for the manuscript CH assisted with animal care and organ preparation for histologic examination, ... bronchiolitis pattern described by Teabeaut that occurred in some instances following an acute aspiration event in rabbits [18] Analysis of BAL specimens revealed a substantial increase in macrophages and...

Ngày tải lên: 12/08/2014, 15:21

12 330 0
Báo cáo y học: "Response to ‘Pain persists in DAS28 rheumatoid arthritis remission but not in ACR/EULAR remission: a longitudinal observational study’" potx

Báo cáo y học: "Response to ‘Pain persists in DAS28 rheumatoid arthritis remission but not in ACR/EULAR remission: a longitudinal observational study’" potx

... Smolen J, Aletaha D, van Riel PLCM: Validation of the 28-joint Disease Activity Score (DAS28) and European League Against Rheumatism response criteria based on C-reactive protein against disease progression ... progression in patients with rheumatoid arthritis, and comparison with the DAS28 based on erythrocyte sedimentation rate Ann Rheum Dis 2009, 68:954-960 Inoue E, Yamanaka H, Hara M, Tomatsu T, Kamatani ... doi:10.1186/ar3393 Cite this article as: Yoshida K, et al.: Response to ‘Pain persists in DAS28 rheumatoid arthritis remission but not in ACR/EULAR remission: a longitudinal observational study’ Arthritis...

Ngày tải lên: 12/08/2014, 17:22

2 279 0
Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx

Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx

... response in the asthmatic might be that myosin bridges never see strains that large This is perhaps because the majority of the mechanical strain in the asthmatic airway during a DI is taken up by increased ... cytoskeleton are surely important factors, but how they interact and details about underlying mechanisms remain unclear Muscle shortening velocity also seems to be an important factor [4,25,26] In addition, ... among airway–parenchymal interactions, lung responsivness, and inflammation in asthma Chest 1995, 107(3):148S-152S Loring SH, Ingram RH Jr, Drazen JM: Effects of lung inflation on airway and tissue...

Ngày tải lên: 12/08/2014, 18:20

3 252 0
Báo cáo khoa học: " Predicting a low cortisol response to adrenocorticotrophic hormone in the critically ill: a retrospective cohort study" pdf

Báo cáo khoa học: " Predicting a low cortisol response to adrenocorticotrophic hormone in the critically ill: a retrospective cohort study" pdf

... of etomidate and the interval between intubation and the test were associated with low response in univariate analysis but not in multivariate analysis Mechanical ventilation did not predict a ... [14] also used blood albumin level as a surrogate marker of plasma cortisol binding capacity Low albumin levels were associated with low baseline cortisol values and increases However, hypoalbuminaemia ... platelets to a low response, independent of sepsis or infection, may be caused by circulating factors promoting platelet aggregation and impairing adrenal function; alternatively, it may be associated...

Ngày tải lên: 13/08/2014, 03:21

10 310 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... to account for increases in cell size after cell cycle arrest and applied to calculated NAD+ concentrations Table 1234 MAG1F TCAACAGATCAGTGGCCAAG 1235 MAG1R GCACATTTTGCTGGGTCTTT 1246 RNR3F CAGGGTTTGGCCGATACTTA...

Ngày tải lên: 14/08/2014, 21:20

17 432 0
Community based adaptation to climate change in settlement development programmes among the urban poor a case study of metro manila

Community based adaptation to climate change in settlement development programmes among the urban poor a case study of metro manila

... (UPAO) Town government (Barangay) Barangay Baesa, Quezon City, Metro Manila Barangay Bagong Silangan, Quezon City, Metro Manila Barangay San Isidro, Montalban, Rizal Barangay San José, Montalban, ... Manila includes the following 16 cities and municipality: City of Manila, Caloocan, Las Piñas, Makati, Malabon, Mandaluyong, Marikina, Muntinlupa, Navotas, Pasay, Pasig, Parañaque, Quezon, San Juan, ... global warming are likely to cause a myriad of climate change impacts, including: increasing warm spells and heatwave frequency for most land areas; increasing intensity and frequency of heavy...

Ngày tải lên: 10/09/2015, 09:07

379 371 0
Tài liệu Freshwater ecosystem adaptation to climate change in water resources management and biodiversity conservation doc

Tài liệu Freshwater ecosystem adaptation to climate change in water resources management and biodiversity conservation doc

... 3.5 THE Tocantins-Araguaia River Basin in the Greater Amazon Description of the Basin The Tocantins-Araguaia River basin (TARB) is situated in the north-central portion of Brazil in the greater Amazon ... ensure auto-adaptation of ecosystems and species • Instituting environmental flow plans aimed at maintaining the natural flow regime (and a more natural sediment load) of the Tocantins, Araguaia, and ... precipitation are likely to lead to changes in demand for water In irrigated agriculture, increased temperatures are likely to lead to increased evapotranspiration, increasing water demand, and decreasing...

Ngày tải lên: 16/02/2014, 10:20

69 415 0
w