... KS300 analysis program (Zeiss) Percentage of immunostained area (area of immunostaining/total image area × 100) was Page of 19 (page number not for citation purposes) Journal of Neuroinflammation ... panel) B Image analysis of thioflavine staining or CD45 immunoreactivity in cortex and hippocampus of animals untreated or immunized at 12–16 months Mean of each animal is the average of two sections ... with oligo A or fAβ Characteristic of fibrillar amyloid plaques in both human AD brain and in mouse models of amyloid accumulation is robust association of activated astrocytes, which can be envisioned...
Ngày tải lên: 19/06/2014, 22:20
... Corporate Taxation in a Dynamic World Paolo M Panteghini Corporate Taxation in a Dynamic World With Figures and Tables 123 Professor Paolo M Panteghini University of Brescia Department of Economics ... one hand, the cost of capital in the start-up stage is raised by dividend taxation On the other hand, capital gains taxation, levied in the second stage, acts as a balancing force on the start-up ... worse and the firm can abandon its business activity and realize the resale value (if any) of its capital on second-hand markets; As Dixit and Pindyck (1994) point out undertaking investment takes...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo y học: "A dynamic model of gene expression in monocytes reveals differences in immediate/early response genes between adult and neonatal cells" potx
... physiologic modelling is another means of corroborating array findings and provides the advantage of providing an approach for immediately testing the biological relevance of microarray data before embarking ... technique, was used to determine and spatially map gene-to-gene interactions [21] All statistical analysis was performed in Matlab R14 (Natick, MA) and Statistica v7 (Tulsa, OK, USA) An alpha level of ... 0.05 was considered statistically significant for all analyses Analysis of the apoptosis assays was undertaken using both parametric and non-parametric analysis methods Parametric analysis was undertaken...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: "Kinematic and dynamic gait compensations in a rat model of lumbar radiculopathy and the effects of tumor necrosis factor-alpha antagonis" ppsx
... distribution was determined preoperatively and again on day using an incapacitance meter (IITC, Inc.) Briefly, an incapacitance meter consists of two scales and specialized caging to encourage a rearing ... Kinematic and dynamic gait compensations in a rat model of lumbar radiculopathy and the effects of tumor necrosis factor-alpha antagonism Kyle D Allen1,2, Mohammed F Shamji1,3, Brian A Mata2, ... percentage stance times of and a gait symmetry variable of approximately 0.5 A shift in either of these variables would indicate a shift away from balanced, symmetric gait For the statistical analyses...
Ngày tải lên: 12/08/2014, 17:22
Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis
... published in Journal of Pharmacology and Experimental Therapeutics and Journal of Cellular and Molecular Medicine Yung-Hua Koh, Ramasamy Tamizhselvi, and Madhav Bhatia Extracellular signalregulated kinase ... animal models of AP (Thrower et al., 2008) For example, a supramaximal concentration of caerulein (107 M) causes intra-acinar cell activation of trypsinogen and increased trypsin activity (Hofbauer ... are critical pro-inflammatory mediators in AP and the associated lung injury SP-NK1R interaction is also a determinant of inflammatory edema in acute interstitial pancreatitis (Maa et al., 2000b)...
Ngày tải lên: 09/09/2015, 17:54
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... mitochondrial Peroxiredoxin Annexin A5 Annexin A2 Aldolase A Fascin Pyruvate kinase VDAC-2 Stathmin Ran1BP GSTp C1qBP Profilin Enolase RuvB-like CRMP4 Lamin A ⁄ C Mitofilin, p32 GAPDH ATP synthase a P05387 ... eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄ L12, annexin A2 , annexin A5 , aldolase A, fascin and peroxyredoxin 1] displayed quantitative differences, regardless of whether or not a- synuclein ... Proteomics of a PD model T Alberio et al overexpression, parkin and PTEN-induced putative kinase loss -of- function and UCHL1 mutation, lead to an impairment of neuronal dopamine homeostasis by interfering...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... with a table that contains each ~-expression and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands, the correct denotational relationship ... III Dynamic models contain incomplete information, and the sets, relations, and functions in these models can be incompletely specified (their domains are usually incomplete) In PTQ, some phrases ... relationship is maintained by expanding the image in the table using the ~-expression, and then finding the corresponding element in the model If the element in the model that was the denotation of the...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... the National Natural Science Foundation of China (No 30672438) and the Hubei Provincial Natural Science Foundation of China (Nos 2006ABC009 and JX 4A0 6) Author details Department of Radiation and ... LLC and A5 49 cell lines were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and maintained in 5% CO2 at 37°C in Dulbecco’s minimum essential medium (DMEM) containing ... transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; Cr: Creatinine Acknowledgements This work was supported by grants...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Combination immunotherapy and active-specific tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer" pdf
... D: A phase II study of G17DT in gastric carcinoma Eur J Surg Oncol 2004, 30:536-543 Sato Y, Fujiwara T, Mine T, Shomura H, Homma S, Maeda Y, Tokunaga N, Ikeda Y, Ishihara Y, Yamada A, Tanaka N, ... All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests References Catalano V, Labianca R, Beretta GD, Gatta G, de Braud ... injected days before vaccination and tumor vaccinations were repeated every two weeks for a total of vaccinations In vitro T cell activation and expansion For T cell analyses, mice were vaccinated...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot
... Dinarello CA, Novick D, Rubinstein M, Otto VI, Rancan M, Kossmann T, Redaelli CA, Trentz O, Shohami E, Stahel PF: Elevated intracranial IL-18 in humans and mice after traumatic brain injury and ... murine brain: (1) The first part of the experimental study was designed to investigate a potential role of TNF-dependent regulation of intracranial IL-18 expression in a standardized model of ... impairment in young people in industrialized countries [1,2] The neuropathological sequelae of brain injury are mediated in large part by a profound host-mediated intracranial inflammatory response...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " CD200-CD200R dysfunction exacerbates microglial activation and dopaminergic neurodegeneration in a rat model of Parkinson’s disease" pot
... were analyzed and each sample was analyzed in duplicate Statistical analysis Statistical analysis of the data was performed using GraphPad Prism version 5.00 for Windows (GraphPad Software, San ... were obtained from a rat brain atlas by Paxinos and Watson The injection was made at a rate of μl/ using a 10 μl Hamilton syringe with a 26-gauge needle At the end of each injection, the syringe ... Contralateral rotation measurements following administration of apomorphine in each experimental group are shown in bar graph at days and 21 days post-6-OHDA injection Data are presented as mean...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc
... the National Natural Science Foundation of China (No 30672438) and the Hubei Provincial Natural Science Foundation of China (Nos 2006ABC009 and JX 4A0 6) Author details Department of Radiation and ... LLC and A5 49 cell lines were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and maintained in 5% CO2 at 37°C in Dulbecco’s minimum essential medium (DMEM) containing ... transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; Cr: Creatinine Acknowledgements This work was supported by grants...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo khoa học: "Altered expression of thioredoxin reductase-1 in dysplastic bile ducts and cholangiocarcinoma in a hamster model" pptx
... ,doirep latnemirepxe eritne eht tuohguorht mutibil da retaw pat gniknird dna )aeroK ,gnaymaS( teid lamron a nevig erew slaminA aeroK ni ytisrevinU lanoitaN nowgnaK ta ytilicaf lamina devorppa na ni ... edixO cirtiN sisenegonicrac detaidem-noitammalfni fo ledom a : htiw detcefni sretsmah ni egamad AND evitartin inirreviv sihcrohtsipO dna evitadixo detaidem-ON fo msinahceM S ihsinawaK ,P nrowahtihtiS ... noitanimulli krad/thgil h 21 a rednu )Co62~22( erutarepmet moor ta deniatniam dna deilppus saw ria deretlif-erp hcihw ot kcar naelc a ni egac etanobracylop rep evif desuoh erew yehT )napaJ( CLS...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Functional recovery and neural differentiation after transplantation of allogenic adipose-derived stem cells in a canine model of acute spinal cord injury" potx
... vacuolar formations Cavitation of the gray matter was seen within cranial and caudal lesions of the SCI site Vacuolar formations and cavitation acted as a physical barrier to the growth of anatomically ... and cresyl violet stain, H, H1, H2 and H3: Immunofluorescence staining Scale bars = 50 μm Transplantation of ASCs in spinal cord injury 281 Fig Immunofluorescence staining of ASC group; A1 -A3 : ... tissues and adhesions in the dura mater Most dogs had mild vacuolar formations Cavitation of the gray matter was seen within cranial and caudal lesions of the SCI site The areas positively stained...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo y học: "A comparative study of anxiety and depression in patients with bronchial asthma, chronic obstructive pulmonary disease and tuberculosis in a general hospital of chest diseases" ppsx
... closely related to relapses and aggravations of respiratory disease, especially in men, pointing to a link between psychological factors and chronic pulmonary disease [19] Patients with COPD cannot ... disease conditions and it is known that adaptation is a crucial survival factor in chronic diseases [22] Conclusion Patients suffering from BA and COPD have a significantly higher rate of anxiety ... factor that leads BA and COPD patients to frequent hospital admissions and even intensive care unit hospitalizations [20] It is accepted that current psychiatric practice has valid ways to diagnose...
Ngày tải lên: 08/08/2014, 23:20
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps
... (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 (5'ATGGAGCTGCAAGGGGTGAG, 3'-CCCGTCACCTCCAATCCAAG), and ... treated with DNase I (Takara, Ohtsu, Japan), and RT-PCR was carried out using OneStep RT-PCR Kit (Qiagen) and the following primers: β-actin (5'-GTCCTCTCCCAAGTCCACACA, 3'-CTGGTCTCAAGTCAGTGTACAGGTAA), ... joints, and pathways controlling the proliferation of RA FLS include an NF-κB-dependent pathway [32] Representative data shown in Fig indicate that RA FLS incorporate a certain amount of [3H]thymidine...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt
... units (AEU) relative to a standard positive sample that was assigned a value of 100 AEU The data are presented as mean ± standard error of the mean Statistics were performed comparing autoantibody ... within that grade of glomerular hypercellularity Grades to IV are as described in Materials and methods ash.DNase I, actin-resistant, salt-resistant and hyperactive mutant of DNase I; wt.DNase ... hours at 37°C DNase activity in the supernatants was measured by DNA-MG assay, as set out below DNA-methyl green assay DNase I activity in urine and supernatant samples was quantified using the...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
... guidelines of the Institutional Animal Care and Use Committee Autoantigen microarrays Antigens were printed in ordered arrays on FAST slides (Whatman, now part of GE Healthcare, Piscataway, NJ, USA) Arrays ... USA) PJU was a member of the scientific advisory boards of Monogram Biosciences, Inc (South San Francisco, CA, USA) and XDx, Inc (Brisbane, CA, USA) and is a cofounder of and consultant to Bayhill ... correlation similarity metric and complete linkage method was applied, and results were depicted as a heatmap and dendogram generated using Java Treeview software [36] A full list of antigens included...
Ngày tải lên: 09/08/2014, 14:22
Quantitative evaluation of motor function before and after engraftment of dopaminergic neurons in a rat model of Parkinson''''s disease ppt
... changes in rats after unilateral 6OHDA lesioning and dopaminergic neuron grafting Some of the dynamic and static parameters were altered in rats with 6-OHDA-induced lesions including paw contact ... during walking In conclusion, the CatWalk-assisted automated gait analysis system revealed that unilateral infusion of 6-OHDA leads to functional changes in static and dynamic gait parameters ... evaluate gait changes before and after transplant of dopamine neurons derived from embryonic stem cells (ES cells) in a unilateral 6-OHDA rat model of PD Materials and methods Animals and housing...
Ngày tải lên: 10/08/2014, 05:21