regression analysis of fatigue at various shoulder postures in sitting

... arms, at the expense of a higher grade and incidence of neutropenia, hepato-biliary and gastrointestinal toxicity for patients receiving motesanib For the second line setting of HER-2 negative patients, ... populations with regard to the treatment line In the meta -analysis conducted by Lee et al, with populations more correctly grouped by line of treatment rather than medication, the benefit of the ... anthracyclines in a part of the study RIBBON-1) in combination with Bevacizumab [33], this advantage not seem to get in combination with capecitabine, although the latter are grouped in heterogeneous...

Ngày tải lên: 10/08/2014, 10:21

... temperature peak appears in the cathode catalyst layer, implying that major heat generation takes place in the region In general, the temperature at the cathode side is higher than that at the ... can be seen that for a planar shape, a high fraction of the current is generated at the catalyst layer that lies beneath the air inlet area, leading to under-utilization of the catalyst under ... electrolyser mode in a unitized regenerative fuel cell, (iv) greater cathode surface that increases the amount of oxygen reduction, the rate of which is slower than the hydrogen oxidation rate In addition,...

Ngày tải lên: 05/09/2013, 14:58

... appreciating someone, offering help and giving encouragement strategies in relatively- English used greater number of strategies in business plan, saying sorry, attending summer holiday situations ... than in the relatively- familiar situations attending summer holiday situations 4.4.USE OF STRATEGIES BY SITUATIONS 4.2 OVERALL USE OF STRATEGIES 4.4.1 Choice of encouraging strategies in high- ... these strategies can work well in performing an act of encouraging, namely: appreciating someone, reassuring h’s feelings, offering help, predicting better future possibilities, suggesting things...

Ngày tải lên: 26/11/2013, 13:31

... starting from the proteins grouped as above (Tables S2 and S3) In both cases, bioinformatic analysis revealed that the NF-jB pathway could be involved in determining the effects of dopamine treatment ... or regulatory proteins were suggested to be linked to early stages of PD pathogenesis [26] Interestingly, in our model, dopamine induces an increase of the actin bundles regulator fascin [27] ... cells in the presence of catalase only (cat) or in the presence of catalase and 0.250 mm dopamine for 24 h (DA) Dopamine treatment significantly increased the expression of a-synuclein in b-gal...

Ngày tải lên: 15/02/2014, 01:20

... association, frequency of meeting attendance, members’ effective participation in the decision making of associations, payment of dues and the community orientation of associations Combining these variables, ... mainly because of difficulties in obtaining data on household income Narayan & Pritchett (1999) claimed that even if it is possible to obtain income data, the presence of “saving and dissaving” ... According to social capital theory, other influences on household income can include information sharing through social relations, trust, and reciprocity Information sharing facilitates the flow of...

Ngày tải lên: 22/02/2014, 09:20

... replacement rate Depending on what type of data is used, the methods can be grouped into three categories: synthetic analysis, empirical data based analysis, and simulated data based analysis A ... details of the observation filtering in this analysis Table Observation Filtering in LII Condition Case Total Number of Observations Total Number of Individuals Exclude Zero Weight Age 55-75 in the ... one of the main goals of replacement rate analysis is to evaluate how well the welfare standard is maintained after retirement By using the counterfactual income as the denominator, the rate...

Ngày tải lên: 05/03/2014, 18:20

... error rate for all of the examined morphemes The result is shown in Fig We found that about 50% of examined morphemes would be found as errors at the beginning of the examination and about 20% of ... accuracy of the morphological information in the CSJ within the limited nunciation The result of morphological analysis, therefore, is a row of morphemes that not have information on actual pronunciation ... Its Part -of- Speech Estimation Using Distributional Analysis In Proceedings of COLING, pages 1119–1122 M Nagata 1999 A Part of Speech Estimation Method for Japanese Unknown Words Using a Statistical...

Ngày tải lên: 17/03/2014, 06:20

... rate of AT- MSCs decreases during hepatic differentiation Thus, the results of GO analysis suggest that Gene signaling pathways in AT- MSC-Hepa Elucidating the gene network pathway functioning in AT- MSC-Hepa ... underlying the differentiation of AT- MSCs into hepatocytes In this report, we clearly demonstrated the utility of microarray analysis in proving the hepatic differentiation of AT- MSCs Moreover, analysis ... pathway The number of genes up-regulated in AT- MSC-Hepa, when compared with human hepatocytes, in each pathway was similar to that of human liver, indicating that biological pathways related to liver...

Ngày tải lên: 30/03/2014, 04:20

... OS-1b,c a Minor amounts of sialylated Hex3 glycoforms were indicated b Minor amounts of Hex2 and Hex3 glycoforms lacking acetyl groups or containing a second glycyl group were indicated c Very minor ... dissolved in water/acetonitrile (1 : 1) to a concentration of mgÆmL)1 Sample solutions were injected via a loop into a running solvent of water/ acetonitrile (1 : 1) at a flow rate of 10 lLÆmin)1 CE-ESIMS/MS ... Hep in the relative proportions 25 : : 12 : 32 : 25 Methylation analysis of dephosphorylated OS-1 showed significantly increasing amounts of terminal Glc and 2-substituted Hep, thereby indicating...

Ngày tải lên: 31/03/2014, 21:21

... in so far permeable that they are able to receive all water from snowmelt including potential rainfall without the origin of surface runoff In mountain locations of Central Europe, freezing of ... importance In the spruce and beech stands, overland flow including the lateral flow of water through soil (interflow) ranged at a level of ± 4% of winter precipitation in 2005/2006 In the following ... the snow melting was reduced at very low air temperatures or quite interrupted in the open area In the final stage of melting in the last decade of April, the snow melting rate in spruce reached...

Ngày tải lên: 07/08/2014, 04:20

... expected paternities under random mating, taking into account the number of ramets of each genet in the stand 4.1 Interspecific matings Two studies report on natural mating of P nigra females in artificial ... detected at any of the three isozyme loci investigated (pgi-2, pgm-2, lap-1) Analysis of the locus win3 resulted in a clear banding pattern for 151/155 seedlings investigated Data for 4/155 seedlings ... populations may therefore be in danger of being lost through genetic assimilation [30] In the latter case, efforts should focus on maintaining and expanding the remaining non-hybrid native populations...

Ngày tải lên: 07/08/2014, 16:20

... fluoride, μg/ml aprotinin, 0.5 mM sodium orthovanadate, and 20 mM sodium pyrophosphate) The lysates were clarified by o centrifugation at 14,000 rpm for 10 and incubated at 95 C in loading buffer (0.125 ... (arrowhead) of intestine (×400) (T) ED 17.5 intestine (×100) 236 Jung-Min Yon et al deionized water to remove any precipitated Tris, and then dehydrated in a series of ethanol and xylene Negative ... blocked with 5% non-fat milk in Tris-buffered saline [TBS; 25 mM Tris (pH 7.4), 200 mM NaCl] for h at room temperature to eliminate nonspecific binding, and were then incubated with the primary...

Ngày tải lên: 07/08/2014, 20:23

... products, including years rotation thinnings between 20 and 40 years of tree age, pruning before the first thinning and clear cutting at an approximate age of 80 years [5] In most of the private-owned ... reconstruction of logs using WoodCimđ and reality in relation to the number of knots and the Z coordinate of knot origin (height in the stem) as mean of deviations (real-reconstructed, in mm) and ... published for Pinus pinaster Ait Further studies and an increased sampling will allow the gathering of more comprehensive information to be used as a tool for optimising the industrial processing, i.e...

Ngày tải lên: 08/08/2014, 01:21

... observed in the mature wood It is generally agreed that the development of water stress in trees influences almost every aspect of wood formation, including the duration of cambial activity [36] Water ... that a complete drying of the soil profile was allowed The drought stress has been interrupted only by rainfall or by small application of irrigation to prevent death of trees 521 Analysis of ... [35] Treatment B was subjected to a series of irrigation and drying cycles This created high fluctuations in soil water deficits during the two years of observation Treatment C was droughted in a...

Ngày tải lên: 08/08/2014, 14:20

... T.X., Patterns of biological production and its mathematical models for main forest types of China, Ph.D Dissertation, Committee of Synthesis Investigation of Natural Resources, Chinese Academy of ... interpolation of climate data due to the low density of weather stations in some areas, and the influence of sharp changes in elevation may lead to uncertainties in the relationship between climate and NPP ... climate data used in this study are an interpolation from weather station records, rather than actual measurements from the study sites or nearby weather stations Errors in the interpolation of...

Ngày tải lên: 08/08/2014, 14:21

... the adequacy of chronology replication for climatic investigation 2.2 Climate data Climate records of the meteorological station in proximity of the sampling site are very short-extending only two ... by correlating overlapping 50-year segments of all measured series using the program COFECHA [10] This program helps in identifying segments of a core or group of cores for which dating or measurement ... precipitation accounts for about 3-10 % of the annual precipitation Weather records of the Chiri mountain experimental station (750 m elevation) for 1975-1986 [15] indicate that mean monthly temperature...

Ngày tải lên: 09/08/2014, 04:20

... binding at the same time Moreover, the administration of GR agonists results in a significant down-regulation of the expression of GR in vitro and in vivo, so we detected GR of SLE patients in ... before the treatment rather than during the treatment In summary, these data suggest that down-regulation of GR expression and binding might mediate steroid resistance in some patients with SLE ... expression and binding of GRs in SS patients compared with those in controls except for the binding of GR in T lymphocytes Similar results were also found in patients with nephrotic syndrome (data not...

Ngày tải lên: 09/08/2014, 14:22

... groEL-groES, involved in folding of new proteins as well as in proper assembly of unfolded proteins and refolding of misfolded proteins generated under stress conditions [74] DnaK is also involved in chromosomal ... CGGCCGCGGGTTT AAGGGGATAAATT and ACT GGCGGCCGCAAG GGCCGATCGAGATCCAC in the case of ecfG2; CACCGCGGCCGCAGCTGC AGGATCT TATGGGAATA and ACTGGCGGCCGCCGACGACCAGATCCTGAT CGC in the case of CH00371) that carried ... phenotypic analysis of three novel downstream regulators during stationary phase, that is, ecfG2, CH00371, and prkA, allowed us to obtain additional insight into the intricate regulatory role of this...

Ngày tải lên: 09/08/2014, 22:23

... first report of the frequency of the -158 Xmn I Ggglobin polymorphism in patients with HbE/b-thalassemia major in Southern China These data suggest that screening of the -158 Xmn I Gg-globin polymorphism ... associated with increased HbF systhesis (rp = 0.588) In HbE/b-thalassemia, particularly in the major cases, during hematopoietic stress, point mutation at G-gamma promoter (the -158 Xmn I Gg-globin ... in early childhood may help on the management of HbE/b-thalassemia major patients and possibly prevent severe complications in Southern China Acknowledgements We are grateful to the investigators,...

Ngày tải lên: 10/08/2014, 22:21

... ovaries of tomato flowers at 3DPA in pollinated or GA3 treated ovaries We investigated the differences in ethylene related genes between the carpels of the two lines We found that ACO5 (1-aminocyclopropane-1-carboxylic ... did not find any cytokinin related genes differentially modulated in parthenocarpic fruit set, which suggest that parthenocapy in the pat-3/pat-4 system might be independent of cytokinins action ... found that genes like CYCLIN D3:2, that are known to be repressed at the anthesis stage in tomato and activated at 2DPA in pollinated ovaries [31,32], were actually activated at the anthesis of the...

Ngày tải lên: 12/08/2014, 03:20